View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9519_low_10 (Length: 235)
Name: NF9519_low_10
Description: NF9519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9519_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 12 - 223
Target Start/End: Original strand, 43578556 - 43578767
Alignment:
| Q |
12 |
cagagagaacagaaagagagcaattttgatgcagagaggcttgctgctgcaagaaaacggcttcaagcgaactacaaagaggctgataatggttgaaatt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43578556 |
cagagagaacagaaagagagcaattttgatgcagagaggctggctgctgcaagaaaacggcttcaagcgaactacaaagaggctgataatggttgaaatt |
43578655 |
T |
|
| Q |
112 |
ttgtttctataattttcattttcatgctagttttctctgtatatagtataaaactgacctaaagttttgtgtgttgtttatagcaaaaaagcaaagaaca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43578656 |
ttgtttctataattttcattttcatgctagttttctctgtatatagtataaaactgacctaaagtttcgtgtgttgtttatagcaaaaaagcaaagaaca |
43578755 |
T |
|
| Q |
212 |
attcaggtgatg |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43578756 |
attcaggtgatg |
43578767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University