View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9519_low_6 (Length: 243)
Name: NF9519_low_6
Description: NF9519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9519_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 7 - 225
Target Start/End: Complemental strand, 45882007 - 45881788
Alignment:
| Q |
7 |
ataaattgcaaataatgcccaaaccttcaatgttttgaccaaattaaactctgatattgtaaaatctaacttcatatgatctattgatcggtactattaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45882007 |
ataaattgcaaataatgcccaaacctttaatgttttgaccaaattaaactttgatattgtaaaatctaacttcatatgatctattgatcggtactattaa |
45881908 |
T |
|
| Q |
107 |
tatatttttcttactcaccagtaccataaataaacagttgattaagcacatagggtag-nnnnnnnnnctgacaagaagcacatagggtagttattagtg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45881907 |
tatatttttcttactcaccagtaccataaataaacagttcattaagcacatagggtagttttttttttctgacaagaagcacatagggtagttattagtg |
45881808 |
T |
|
| Q |
206 |
gatattctcttgtttggttt |
225 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45881807 |
gatattctcttgtttggttt |
45881788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University