View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9521_10 (Length: 302)
Name: NF9521_10
Description: NF9521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9521_10 |
 | |
|
| [»] scaffold0011 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0011 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 12 - 274
Target Start/End: Complemental strand, 229905 - 229643
Alignment:
| Q |
12 |
agagatatatagattctttattatgacttcatcagaacctggcttcaacgaaagaccaaaagcctcagtttttacttcaaaatgggactcctttggggaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
229905 |
agagatatatagattctttattatgacttcatcagaacctggcttcaacgaaagaccaatagcctcagtttttacttcaaaatgggactcctttggggaa |
229806 |
T |
|
| Q |
112 |
tcttcaatgtgatgctttatcactatgtatttgttggtcacttccatttcactttgcttagttgctaattctctggtattagctatatagtttcattaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
229805 |
tcttcaatgtgatgctttatcactatgtatttgttggtcacttccatttcactttgcttagttgctaattctctggtattagctatatagtttcattaat |
229706 |
T |
|
| Q |
212 |
tttaagttttctgaaattggttatataatcgtaagagtagtaactagtaaataaagaaagtta |
274 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||| |
|
|
| T |
229705 |
tttaagttttctgaaattggttatataatagtaagagtagtaactagcaactaaagaaagtta |
229643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University