View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9521_8 (Length: 311)
Name: NF9521_8
Description: NF9521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9521_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 6e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 8 - 166
Target Start/End: Complemental strand, 47772943 - 47772788
Alignment:
| Q |
8 |
tgagaagaaagactggacaaaagggttttaaggttgttgttgtaggtactattggacgtgtaattgcctatgtcgttatcacaggaataagaatcatcag |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||| |||||||| ||||| |||||||||| ||||||||| ||| | |||||| | |
|
|
| T |
47772943 |
tgagaagaaagactggacaaaagagttttaaggttgttgtcataggtgctattggatgtgtagttgcctatgttgttatcaca-taat--gcatcatcgg |
47772847 |
T |
|
| Q |
108 |
cttttgcatggtatgcagctatgnnnnnnngataacaaagaaagggaaatagagccatt |
166 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47772846 |
cttttgcatggtatgcagctatgaaaaaaagataacaaagaaagggaaatagagccatt |
47772788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 11 - 90
Target Start/End: Complemental strand, 47764550 - 47764471
Alignment:
| Q |
11 |
gaagaaagactggacaaaagggttttaaggttgttgttgtaggtactattggacgtgtaattgcctatgtcgttatcaca |
90 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||| |||||| ||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
47764550 |
gaagaaaaactggaaaaaagggttttaaggttgttgtcgtaggtgctattggctgtgtaattgcctctgttgttatcaca |
47764471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University