View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9522_low_10 (Length: 239)
Name: NF9522_low_10
Description: NF9522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9522_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 22 - 224
Target Start/End: Original strand, 32098983 - 32099185
Alignment:
| Q |
22 |
tcttcatccatgtcgtcttgattgggatttgtagagggtgggtctgccatggtgtacatgatggtaggaatgtgattggttgaggaagttgggttagagg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32098983 |
tcttcatccatgtcgtcttgattgggatttgtagagggtgggtctgccatggtgtacatgatggtaggaatgtgatcggttgaggaagttgggttagagg |
32099082 |
T |
|
| Q |
122 |
ttgagtgttctgagagtgctggctttggcggcaaagagtgaccatctaagaagaagctcttcacatgtttgatgaaattaaggtcttcttgaacctaaga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32099083 |
ttgagtgttctgagagtgctggctttggcggcaaagagtgaccatctaagaagaagctcttcacatgtttgatgaaattaaggtcttcttgaacctaaga |
32099182 |
T |
|
| Q |
222 |
aat |
224 |
Q |
| |
|
||| |
|
|
| T |
32099183 |
aat |
32099185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University