View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9522_low_7 (Length: 249)
Name: NF9522_low_7
Description: NF9522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9522_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 9 - 217
Target Start/End: Original strand, 32098741 - 32098949
Alignment:
| Q |
9 |
cgtgttctaacgggtttccttgattactcacaactaataaatgaaaatctgaatctaaattatttgacccgtcgtttggcgacccgatccgaatatcatc |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32098741 |
cgtgtcctaacgggtttccttgattactcacaactaataaatgaaaatctgaatctaaatgatttgacccgtcgtttggcgacccgatccgaatatcatc |
32098840 |
T |
 |
| Q |
109 |
ggacatttcaatttgcatcaactcacttggctctacaatagccgtcatcgaggttgcacgtcggatacgacctcctgtttcgtcttcagactcggattca |
208 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32098841 |
gggcatttcaatttgcatcaactcacttggctctacaatagccgtcattgaggttgcacgtcggatacgacctcctgtttcgtcttcagactcggattca |
32098940 |
T |
 |
| Q |
209 |
acttcgtcg |
217 |
Q |
| |
|
||||||||| |
|
|
| T |
32098941 |
acttcgtcg |
32098949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University