View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9522_low_9 (Length: 239)

Name: NF9522_low_9
Description: NF9522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9522_low_9
NF9522_low_9
[»] chr1 (1 HSPs)
chr1 (22-224)||(32098983-32099185)


Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 22 - 224
Target Start/End: Original strand, 32098983 - 32099185
Alignment:
22 tcttcatccatgtcgtcttgattgggatttgtagagggtgggtctgccatggtgtacatgatggtaggaatgtgattggttgaggaagttgggttagagg 121  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
32098983 tcttcatccatgtcgtcttgattgggatttgtagagggtgggtctgccatggtgtacatgatggtaggaatgtgatcggttgaggaagttgggttagagg 32099082  T
122 ttgagtgttctgagagtgctggctttggcggcaaagagtgaccatctaagaagaagctcttcacatgtttgatgaaattaaggtcttcttgaacctaaga 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32099083 ttgagtgttctgagagtgctggctttggcggcaaagagtgaccatctaagaagaagctcttcacatgtttgatgaaattaaggtcttcttgaacctaaga 32099182  T
222 aat 224  Q
    |||    
32099183 aat 32099185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University