View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9523_high_11 (Length: 212)
Name: NF9523_high_11
Description: NF9523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9523_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 25 - 194
Target Start/End: Complemental strand, 28856959 - 28856790
Alignment:
| Q |
25 |
ttttccacgtctatgcttgtagccataggattccaacttttccctaaatctcttgagatctttgaagcttctgttatgatcacctgcaaatcaattgcaa |
124 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28856959 |
ttttccacgtctatgcttggagccataggattccaacttttccctaaatctcttgagatctttgaagcttcagttatgatcacctgcaaatcaattgcaa |
28856860 |
T |
|
| Q |
125 |
tattttgtatgatgataccatcctctttgctagcacttaggtagtataatgtaaagaaacatcccctttg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28856859 |
tattttgtatgatgataccatcctctttgctagcacttaggtagtataatgtaaagaaacatcccctttg |
28856790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 25 - 194
Target Start/End: Complemental strand, 17997192 - 17997023
Alignment:
| Q |
25 |
ttttccacgtctatgcttgtagccataggattccaacttttccctaaatctcttgagatctttgaagcttctgttatgatcacctgcaaatcaattgcaa |
124 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17997192 |
ttttccaagtctatgcttggagccataggattctaacttttccctaaatctcttgagatctttgaagcttctgttatgatcacctgcaaatcaattgcaa |
17997093 |
T |
|
| Q |
125 |
tattttgtatgatgataccatcctctttgctagcacttaggtagtataatgtaaagaaacatcccctttg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17997092 |
tattttgtatgatgataccatcctctttgctagtacttaggtagtataatgtaaagaaacatcctctttg |
17997023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University