View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9523_high_2 (Length: 501)

Name: NF9523_high_2
Description: NF9523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9523_high_2
NF9523_high_2
[»] chr1 (81 HSPs)
chr1 (20-320)||(21723512-21723811)
chr1 (365-490)||(21723811-21723936)
chr1 (239-355)||(35253181-35253297)
chr1 (237-353)||(27474325-27474441)
chr1 (237-351)||(46247952-46248067)
chr1 (256-346)||(4349702-4349792)
chr1 (236-345)||(23768325-23768435)
chr1 (237-346)||(46991848-46991958)
chr1 (237-354)||(34725094-34725210)
chr1 (237-351)||(6925144-6925259)
chr1 (237-351)||(31382213-31382327)
chr1 (237-338)||(32632569-32632670)
chr1 (237-351)||(18944687-18944805)
chr1 (256-351)||(42304206-42304303)
chr1 (237-346)||(45402138-45402250)
chr1 (237-353)||(10668269-10668388)
chr1 (237-340)||(14617082-14617186)
chr1 (238-340)||(18741967-18742073)
chr1 (237-320)||(25468293-25468377)
chr1 (237-353)||(30395723-30395842)
chr1 (240-352)||(35005170-35005285)
chr1 (239-351)||(38478281-38478392)
chr1 (237-352)||(41319804-41319920)
chr1 (239-330)||(11596559-11596650)
chr1 (237-330)||(18724565-18724659)
chr1 (237-337)||(19974087-19974188)
chr1 (237-337)||(12126850-12126949)
chr1 (245-317)||(21910682-21910754)
chr1 (264-340)||(44485120-44485195)
chr1 (264-351)||(8197115-8197202)
chr1 (257-340)||(10378745-10378828)
chr1 (257-352)||(19414502-19414597)
chr1 (237-336)||(27201691-27201793)
chr1 (240-351)||(45812536-45812646)
chr1 (237-341)||(2435795-2435901)
chr1 (237-343)||(47214555-47214660)
chr1 (262-351)||(15505634-15505722)
chr1 (240-340)||(35019277-35019377)
chr1 (237-340)||(15511158-15511265)
chr1 (237-353)||(20004087-20004206)
chr1 (237-289)||(22324937-22324989)
chr1 (237-340)||(23796509-23796613)
chr1 (237-340)||(35117775-35117882)
chr1 (251-340)||(31442399-31442489)
chr1 (151-236)||(34725190-34725276)
chr1 (151-236)||(45812629-45812715)
chr1 (266-351)||(1517310-1517395)
chr1 (256-338)||(19932765-19932849)
chr1 (267-340)||(20999860-20999933)
chr1 (236-289)||(33223027-33223080)
chr1 (256-336)||(43207559-43207640)
chr1 (237-353)||(6983808-6983923)
chr1 (239-289)||(17470407-17470458)
chr1 (151-236)||(14617016-14617102)
chr1 (151-236)||(20004186-20004272)
chr1 (151-236)||(27474259-27474345)
chr1 (151-236)||(32632650-32632736)
chr1 (151-236)||(41319900-41319986)
chr1 (262-340)||(43768209-43768287)
chr1 (155-236)||(45402077-45402158)
chr1 (151-236)||(46991782-46991868)
chr1 (151-232)||(47214489-47214571)
chr1 (251-320)||(20982780-20982849)
chr1 (239-340)||(23371170-23371270)
chr1 (237-313)||(34148997-34149074)
chr1 (151-227)||(34714601-34714678)
chr1 (240-338)||(19701617-19701717)
chr1 (237-313)||(22930106-22930181)
chr1 (174-236)||(6925101-6925164)
chr1 (237-299)||(18335339-18335402)
chr1 (174-236)||(18724639-18724702)
chr1 (151-236)||(18944621-18944707)
chr1 (151-236)||(22930161-22930247)
chr1 (156-236)||(30395822-30395903)
chr1 (295-340)||(30555218-30555263)
chr1 (237-340)||(39214968-39215073)
chr1 (237-340)||(9939505-9939612)
chr1 (266-338)||(28894570-28894642)
chr1 (306-350)||(50548561-50548605)
chr1 (295-351)||(50606506-50606562)
chr1 (237-337)||(50811983-50812085)
[»] chr4 (75 HSPs)
chr4 (236-346)||(6430630-6430740)
chr4 (237-351)||(5648280-5648394)
chr4 (237-346)||(40915850-40915959)
chr4 (237-351)||(25629070-25629185)
chr4 (237-351)||(20639657-20639773)
chr4 (237-351)||(30639401-30639515)
chr4 (237-351)||(47528529-47528642)
chr4 (237-322)||(5306692-5306777)
chr4 (237-346)||(20225005-20225113)
chr4 (240-352)||(51865036-51865149)
chr4 (237-346)||(7909284-7909394)
chr4 (237-351)||(48598824-48598937)
chr4 (240-340)||(54175088-54175190)
chr4 (257-346)||(29207902-29207991)
chr4 (239-334)||(14983857-14983953)
chr4 (237-329)||(49796819-49796911)
chr4 (240-351)||(9832312-9832422)
chr4 (237-351)||(47443978-47444093)
chr4 (239-353)||(16911585-16911702)
chr4 (256-338)||(30690188-30690270)
chr4 (237-351)||(39077795-39077908)
chr4 (239-339)||(54730272-54730376)
chr4 (237-313)||(17043431-17043508)
chr4 (256-341)||(19027889-19027974)
chr4 (237-346)||(21646985-21647097)
chr4 (242-351)||(23501813-23501925)
chr4 (239-351)||(10277756-10277867)
chr4 (237-340)||(35567191-35567295)
chr4 (237-351)||(9987833-9987948)
chr4 (237-351)||(16408600-16408717)
chr4 (237-337)||(41018807-41018907)
chr4 (264-351)||(3580840-3580926)
chr4 (240-351)||(11054147-11054257)
chr4 (262-346)||(20225121-20225207)
chr4 (239-313)||(47441567-47441642)
chr4 (146-236)||(48598917-48599008)
chr4 (237-340)||(55766476-55766579)
chr4 (151-236)||(5648214-5648300)
chr4 (264-337)||(20908649-20908723)
chr4 (240-346)||(44363134-44363243)
chr4 (237-338)||(55830733-55830834)
chr4 (157-236)||(16408697-16408777)
chr4 (237-346)||(8473624-8473734)
chr4 (236-339)||(30496333-30496435)
chr4 (151-236)||(5306757-5306843)
chr4 (151-236)||(11054240-11054326)
chr4 (151-236)||(21646919-21647005)
chr4 (237-313)||(7385513-7385590)
chr4 (256-338)||(25343228-25343312)
chr4 (265-339)||(30352591-30352667)
chr4 (237-334)||(30581481-30581581)
chr4 (237-332)||(39029078-39029175)
chr4 (251-291)||(12711508-12711548)
chr4 (239-334)||(32629285-32629380)
chr4 (237-336)||(37494872-37494972)
chr4 (279-351)||(38786673-38786745)
chr4 (177-236)||(39077888-39077948)
chr4 (244-351)||(13256398-13256508)
chr4 (237-340)||(32478802-32478899)
chr4 (295-346)||(38755912-38755963)
chr4 (151-236)||(20224939-20225025)
chr4 (237-337)||(21489108-21489210)
chr4 (237-330)||(25463143-25463237)
chr4 (151-236)||(30639335-30639421)
chr4 (276-351)||(33836486-33836563)
chr4 (301-351)||(35532078-35532128)
chr4 (296-346)||(40553941-40553991)
chr4 (151-236)||(47528622-47528708)
chr4 (255-340)||(15053973-15054058)
chr4 (286-346)||(11394923-11394983)
chr4 (286-346)||(11404650-11404710)
chr4 (239-300)||(14590860-14590923)
chr4 (153-236)||(14983791-14983875)
chr4 (295-351)||(32484313-32484369)
chr4 (236-287)||(51420594-51420646)
[»] chr2 (66 HSPs)
chr2 (237-352)||(9671202-9671316)
chr2 (237-354)||(8455312-8455430)
chr2 (237-351)||(10546183-10546299)
chr2 (237-351)||(14444750-14444864)
chr2 (237-351)||(36871514-36871627)
chr2 (237-356)||(11514457-11514576)
chr2 (237-340)||(12023929-12024032)
chr2 (236-351)||(25249737-25249852)
chr2 (237-344)||(30826058-30826164)
chr2 (237-351)||(24200622-24200739)
chr2 (237-351)||(24859987-24860100)
chr2 (237-346)||(14530339-14530451)
chr2 (237-346)||(23397787-23397895)
chr2 (237-346)||(40762238-40762348)
chr2 (237-346)||(10543719-10543831)
chr2 (251-336)||(17896296-17896381)
chr2 (237-353)||(21779258-21779373)
chr2 (237-351)||(17668023-17668138)
chr2 (251-352)||(26684617-26684719)
chr2 (239-351)||(17623587-17623700)
chr2 (251-346)||(25079721-25079816)
chr2 (239-340)||(4516361-4516463)
chr2 (237-313)||(22371078-22371152)
chr2 (237-344)||(25641523-25641630)
chr2 (236-291)||(30864476-30864531)
chr2 (236-346)||(40416875-40416986)
chr2 (256-346)||(25632550-25632640)
chr2 (241-351)||(27573646-27573756)
chr2 (148-236)||(10543650-10543739)
chr2 (239-339)||(21377085-21377185)
chr2 (249-349)||(39499231-39499331)
chr2 (237-343)||(19977721-19977828)
chr2 (151-236)||(12024012-12024098)
chr2 (239-352)||(5841051-5841167)
chr2 (152-236)||(11514392-11514477)
chr2 (264-337)||(24890460-24890533)
chr2 (238-330)||(32781308-32781401)
chr2 (256-340)||(44643564-44643648)
chr2 (239-334)||(99281-99375)
chr2 (237-340)||(17380248-17380350)
chr2 (237-316)||(5450306-5450387)
chr2 (151-236)||(7214489-7214575)
chr2 (237-351)||(7214555-7214672)
chr2 (151-232)||(14530273-14530355)
chr2 (295-345)||(23488563-23488613)
chr2 (256-338)||(31821355-31821437)
chr2 (237-352)||(39914304-39914420)
chr2 (302-350)||(124914-124962)
chr2 (239-351)||(19615015-19615129)
chr2 (240-338)||(44449395-44449495)
chr2 (295-338)||(8575975-8576018)
chr2 (237-338)||(14544084-14544189)
chr2 (302-353)||(22371199-22371250)
chr2 (153-235)||(25249832-25249915)
chr2 (151-236)||(5840983-5841069)
chr2 (239-341)||(17471571-17471676)
chr2 (151-236)||(17705450-17705536)
chr2 (151-236)||(21779353-21779439)
chr2 (151-224)||(22371012-22371086)
chr2 (151-236)||(23397721-23397807)
chr2 (240-312)||(23145736-23145809)
chr2 (240-312)||(23557526-23557599)
chr2 (151-211)||(8455436-8455496)
chr2 (238-289)||(15296468-15296520)
chr2 (165-236)||(17667971-17668043)
chr2 (151-211)||(25079838-25079898)
[»] chr8 (64 HSPs)
chr8 (237-346)||(45071286-45071395)
chr8 (239-346)||(13160725-13160832)
chr8 (237-351)||(18164759-18164873)
chr8 (237-353)||(36720817-36720934)
chr8 (237-351)||(28817625-28817740)
chr8 (240-354)||(31457197-31457311)
chr8 (237-353)||(44530170-44530287)
chr8 (256-351)||(389686-389781)
chr8 (237-340)||(12670260-12670362)
chr8 (237-351)||(35261700-35261815)
chr8 (237-338)||(29877115-29877217)
chr8 (237-355)||(39460989-39461110)
chr8 (237-345)||(29521690-29521799)
chr8 (237-340)||(20284079-20284187)
chr8 (239-339)||(24365071-24365172)
chr8 (244-345)||(5689659-5689761)
chr8 (237-352)||(12625910-12626027)
chr8 (237-351)||(30454096-30454209)
chr8 (237-340)||(21070707-21070816)
chr8 (237-346)||(2626540-2626653)
chr8 (237-320)||(5135319-5135403)
chr8 (256-351)||(8897763-8897858)
chr8 (251-351)||(10857865-10857965)
chr8 (257-353)||(19729382-19729478)
chr8 (237-340)||(7136537-7136643)
chr8 (237-351)||(6760843-6760960)
chr8 (237-351)||(20869944-20870061)
chr8 (151-236)||(35261634-35261720)
chr8 (237-340)||(8483948-8484052)
chr8 (151-236)||(12670342-12670428)
chr8 (237-346)||(17823597-17823707)
chr8 (237-351)||(25250543-25250660)
chr8 (151-232)||(29521783-29521865)
chr8 (151-236)||(30454189-30454275)
chr8 (151-236)||(36720751-36720837)
chr8 (259-351)||(26457773-26457863)
chr8 (237-352)||(26954153-26954272)
chr8 (256-340)||(44742528-44742613)
chr8 (237-309)||(23000260-23000332)
chr8 (256-352)||(40604904-40604999)
chr8 (237-337)||(44781517-44781620)
chr8 (276-351)||(26102578-26102653)
chr8 (174-236)||(26954110-26954173)
chr8 (174-236)||(28407394-28407457)
chr8 (283-346)||(28407471-28407534)
chr8 (237-314)||(35105944-35106023)
chr8 (151-236)||(7136623-7136709)
chr8 (151-236)||(20869590-20869676)
chr8 (151-236)||(40604999-40605085)
chr8 (287-351)||(18595910-18595974)
chr8 (256-336)||(36918165-36918245)
chr8 (256-340)||(16225060-16225146)
chr8 (237-288)||(20869560-20869610)
chr8 (154-236)||(25250480-25250563)
chr8 (300-351)||(27468091-27468142)
chr8 (174-236)||(45071243-45071306)
chr8 (151-236)||(2626474-2626560)
chr8 (151-236)||(17823531-17823617)
chr8 (151-236)||(18164853-18164939)
chr8 (259-293)||(28873242-28873276)
chr8 (240-289)||(43942348-43942398)
chr8 (242-291)||(23286384-23286432)
chr8 (237-336)||(42083712-42083813)
chr8 (237-337)||(17250888-17250991)
[»] chr3 (69 HSPs)
chr3 (237-346)||(22609809-22609918)
chr3 (237-357)||(40272805-40272926)
chr3 (240-339)||(6411833-6411932)
chr3 (237-352)||(29366718-29366836)
chr3 (237-351)||(54484733-54484849)
chr3 (237-353)||(13628787-13628906)
chr3 (239-354)||(16735486-16735601)
chr3 (237-351)||(26869750-26869864)
chr3 (237-346)||(22122921-22123029)
chr3 (243-351)||(15797271-15797378)
chr3 (237-351)||(1217133-1217246)
chr3 (237-346)||(31592892-31593000)
chr3 (240-313)||(47624088-47624161)
chr3 (237-340)||(45948848-45948952)
chr3 (239-346)||(39203561-39203667)
chr3 (237-351)||(46421033-46421151)
chr3 (237-338)||(26573170-26573272)
chr3 (237-337)||(34420656-34420758)
chr3 (257-340)||(34771374-34771457)
chr3 (237-351)||(13730601-13730718)
chr3 (237-334)||(33926126-33926224)
chr3 (240-346)||(45786218-45786327)
chr3 (237-351)||(49013472-49013589)
chr3 (265-351)||(52926218-52926304)
chr3 (237-338)||(10795435-10795539)
chr3 (237-340)||(53996575-53996680)
chr3 (237-352)||(12914033-12914149)
chr3 (237-340)||(14987000-14987106)
chr3 (237-338)||(54374357-54374460)
chr3 (151-236)||(13730698-13730784)
chr3 (256-346)||(353353-353445)
chr3 (151-235)||(52926305-52926390)
chr3 (237-351)||(516452-516570)
chr3 (237-351)||(7943033-7943148)
chr3 (269-352)||(25517168-25517251)
chr3 (151-236)||(7696979-7697065)
chr3 (237-331)||(8247706-8247803)
chr3 (151-236)||(8247783-8247869)
chr3 (243-320)||(9276313-9276390)
chr3 (151-236)||(10870045-10870131)
chr3 (237-291)||(31831242-31831295)
chr3 (237-340)||(52428480-52428591)
chr3 (237-340)||(7696902-7696999)
chr3 (151-236)||(4495758-4495844)
chr3 (244-351)||(44403554-44403663)
chr3 (237-288)||(45620890-45620943)
chr3 (151-236)||(46421131-46421217)
chr3 (239-340)||(50624963-50625065)
chr3 (237-351)||(5173718-5173834)
chr3 (237-349)||(43114869-43114984)
chr3 (293-353)||(10484613-10484673)
chr3 (237-277)||(10870025-10870065)
chr3 (267-338)||(25944543-25944615)
chr3 (244-355)||(26292382-26292493)
chr3 (256-291)||(4495723-4495758)
chr3 (295-338)||(45288067-45288110)
chr3 (151-236)||(1217067-1217153)
chr3 (285-351)||(10300583-10300649)
chr3 (237-330)||(30928167-30928261)
chr3 (151-236)||(39203493-39203579)
chr3 (272-340)||(829452-829521)
chr3 (237-289)||(45139539-45139592)
chr3 (279-336)||(46169981-46170038)
chr3 (302-351)||(47624208-47624257)
chr3 (237-313)||(8410904-8410979)
chr3 (237-288)||(9607246-9607298)
chr3 (237-290)||(21875056-21875111)
chr3 (295-355)||(30452897-30452957)
chr3 (240-350)||(55401222-55401334)
[»] scaffold0057 (3 HSPs)
scaffold0057 (237-351)||(46852-46967)
scaffold0057 (241-336)||(24786-24882)
scaffold0057 (237-354)||(43680-43797)
[»] chr5 (45 HSPs)
chr5 (237-351)||(24448911-24449026)
chr5 (237-352)||(38879602-38879720)
chr5 (237-352)||(41014340-41014455)
chr5 (237-352)||(32703445-32703559)
chr5 (237-346)||(7368419-7368527)
chr5 (240-338)||(7097772-7097870)
chr5 (237-353)||(4619101-4619220)
chr5 (241-340)||(16880657-16880757)
chr5 (237-337)||(19142956-19143056)
chr5 (237-352)||(27328773-27328891)
chr5 (237-351)||(8169983-8170096)
chr5 (237-351)||(35710334-35710447)
chr5 (237-346)||(13801771-13801883)
chr5 (237-340)||(43574627-43574731)
chr5 (239-320)||(2838802-2838883)
chr5 (275-352)||(16957374-16957451)
chr5 (237-340)||(29334416-29334521)
chr5 (262-346)||(34154818-34154902)
chr5 (237-351)||(43334223-43334340)
chr5 (237-336)||(5873336-5873435)
chr5 (240-350)||(30006349-30006460)
chr5 (151-236)||(41014274-41014360)
chr5 (251-340)||(3771375-3771464)
chr5 (241-340)||(208937-209037)
chr5 (151-236)||(24448845-24448931)
chr5 (246-343)||(1850670-1850767)
chr5 (237-346)||(20135625-20135737)
chr5 (266-346)||(1565483-1565562)
chr5 (153-236)||(22861760-22861844)
chr5 (237-351)||(1405208-1405323)
chr5 (295-346)||(25622540-25622591)
chr5 (256-339)||(12006339-12006424)
chr5 (151-236)||(23974736-23974821)
chr5 (151-236)||(35710268-35710354)
chr5 (151-236)||(37024648-37024734)
chr5 (151-232)||(38879536-38879618)
chr5 (266-338)||(12477132-12477205)
chr5 (271-340)||(13774921-13774990)
chr5 (295-352)||(39801596-39801653)
chr5 (262-330)||(22600501-22600569)
chr5 (239-291)||(22907924-22907976)
chr5 (248-351)||(37225960-37226064)
chr5 (153-236)||(43334159-43334243)
chr5 (174-236)||(27328730-27328793)
chr5 (241-340)||(39301148-39301248)
[»] chr7 (69 HSPs)
chr7 (237-350)||(33871910-33872023)
chr7 (237-340)||(19265836-19265938)
chr7 (237-352)||(21172007-21172121)
chr7 (237-346)||(18512457-18512566)
chr7 (237-340)||(2541029-2541133)
chr7 (237-340)||(38604548-38604652)
chr7 (237-351)||(19426889-19427003)
chr7 (237-351)||(32758282-32758395)
chr7 (237-351)||(34626207-34626321)
chr7 (237-351)||(42391099-42391212)
chr7 (237-346)||(10693077-10693185)
chr7 (264-351)||(7879687-7879774)
chr7 (237-351)||(38262195-38262310)
chr7 (239-352)||(40463900-40464013)
chr7 (237-346)||(48735126-48735234)
chr7 (237-339)||(23231578-23231681)
chr7 (241-352)||(35787267-35787378)
chr7 (237-346)||(11617592-11617702)
chr7 (237-351)||(42805545-42805662)
chr7 (237-351)||(47077854-47077967)
chr7 (237-346)||(47716480-47716592)
chr7 (237-353)||(2662933-2663047)
chr7 (267-351)||(27889315-27889399)
chr7 (237-351)||(1408478-1408593)
chr7 (237-351)||(27629655-27629770)
chr7 (237-340)||(35334826-35334928)
chr7 (237-351)||(42798690-42798805)
chr7 (237-340)||(18747507-18747612)
chr7 (239-346)||(29907442-29907549)
chr7 (151-236)||(42798624-42798710)
chr7 (151-236)||(46354149-46354235)
chr7 (151-236)||(47077947-47078033)
chr7 (237-353)||(31591106-31591221)
chr7 (237-351)||(43557493-43557611)
chr7 (155-236)||(7794600-7794682)
chr7 (251-345)||(25198762-25198856)
chr7 (151-236)||(42805479-42805565)
chr7 (151-236)||(47716414-47716500)
chr7 (257-346)||(11741835-11741924)
chr7 (237-330)||(13805123-13805216)
chr7 (256-329)||(19266491-19266564)
chr7 (237-340)||(21566456-21566561)
chr7 (237-305)||(23419719-23419788)
chr7 (256-336)||(8148960-8149039)
chr7 (256-320)||(14099036-14099100)
chr7 (256-320)||(14409053-14409117)
chr7 (264-340)||(28362156-28362231)
chr7 (239-340)||(16341301-16341404)
chr7 (237-312)||(46354215-46354293)
chr7 (151-236)||(18326989-18327075)
chr7 (151-236)||(22699064-22699150)
chr7 (151-236)||(32758216-32758302)
chr7 (272-353)||(23065922-23066003)
chr7 (239-331)||(28078151-28078243)
chr7 (237-305)||(42476894-42476961)
chr7 (174-236)||(1424004-1424067)
chr7 (240-291)||(6736914-6736965)
chr7 (174-236)||(10693165-10693228)
chr7 (237-340)||(32233145-32233248)
chr7 (151-236)||(21447545-21447631)
chr7 (151-228)||(35334916-35334994)
chr7 (268-341)||(36267826-36267900)
chr7 (267-338)||(39123945-39124018)
chr7 (151-232)||(42495933-42496015)
chr7 (151-236)||(43557427-43557513)
chr7 (237-282)||(22065609-22065654)
chr7 (156-236)||(40463837-40463918)
chr7 (237-270)||(42495916-42495949)
chr7 (256-340)||(22698977-22699064)
[»] scaffold0015 (1 HSPs)
scaffold0015 (237-352)||(48632-48746)
[»] chr6 (35 HSPs)
chr6 (237-352)||(1354755-1354869)
chr6 (237-351)||(26097181-26097294)
chr6 (237-351)||(29355854-29355971)
chr6 (237-351)||(1346985-1347098)
chr6 (237-351)||(25557746-25557859)
chr6 (237-351)||(12221913-12222031)
chr6 (237-333)||(32579447-32579543)
chr6 (237-351)||(9161144-9161260)
chr6 (237-337)||(7947384-7947486)
chr6 (256-340)||(3815087-3815171)
chr6 (237-340)||(18277203-18277307)
chr6 (237-351)||(2166409-2166526)
chr6 (237-351)||(2178042-2178159)
chr6 (239-312)||(6024256-6024332)
chr6 (271-352)||(12885967-12886050)
chr6 (237-339)||(33138854-33138957)
chr6 (151-236)||(1346919-1347005)
chr6 (240-336)||(12889450-12889548)
chr6 (151-236)||(14975174-14975260)
chr6 (278-351)||(13267788-13267861)
chr6 (272-353)||(23930124-23930205)
chr6 (237-306)||(28007649-28007717)
chr6 (174-236)||(2166506-2166569)
chr6 (174-236)||(2178139-2178202)
chr6 (243-334)||(24097608-24097696)
chr6 (151-236)||(8409198-8409284)
chr6 (256-289)||(2755485-2755518)
chr6 (152-236)||(3815171-3815256)
chr6 (287-343)||(16915993-16916050)
chr6 (240-291)||(1941879-1941931)
chr6 (295-351)||(6808475-6808531)
chr6 (237-313)||(15865894-15865970)
chr6 (237-313)||(15866076-15866151)
chr6 (237-337)||(23240837-23240936)
chr6 (251-287)||(27855500-27855536)
[»] scaffold0258 (2 HSPs)
scaffold0258 (237-351)||(13023-13137)
scaffold0258 (152-236)||(13117-13202)
[»] scaffold0168 (2 HSPs)
scaffold0168 (237-351)||(30600-30713)
scaffold0168 (151-236)||(30534-30620)
[»] scaffold0180 (1 HSPs)
scaffold0180 (263-351)||(24132-24220)
[»] scaffold1176 (1 HSPs)
scaffold1176 (240-350)||(1587-1696)
[»] scaffold0954 (1 HSPs)
scaffold0954 (237-339)||(3565-3668)
[»] scaffold0311 (1 HSPs)
scaffold0311 (240-337)||(10834-10932)
[»] scaffold0049 (1 HSPs)
scaffold0049 (237-346)||(58998-59110)
[»] scaffold0018 (1 HSPs)
scaffold0018 (264-338)||(72879-72953)
[»] scaffold0223 (1 HSPs)
scaffold0223 (237-338)||(11152-11252)
[»] scaffold0187 (4 HSPs)
scaffold0187 (237-346)||(10054-10162)
scaffold0187 (237-346)||(20382-20490)
scaffold0187 (153-236)||(10142-10226)
scaffold0187 (153-236)||(20470-20554)
[»] scaffold0254 (1 HSPs)
scaffold0254 (174-236)||(4135-4198)
[»] scaffold0194 (1 HSPs)
scaffold0194 (151-224)||(24619-24693)
[»] scaffold0036 (1 HSPs)
scaffold0036 (257-291)||(35076-35110)
[»] scaffold0005 (1 HSPs)
scaffold0005 (239-300)||(226455-226518)


Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 81)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 320
Target Start/End: Original strand, 21723512 - 21723811
Alignment:
Q  20 tcagaggcctcaaaaaggatttggtagaacctaaattaaaatttattcttagtggtagcagttattgctgtaatagtagtgtttatcttttcttttccnn 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      
T  21723512 tcagaggcctcaaaaaggatttggtagaacctaaattaaaatttattcttagtggtagcagttattgctgtaatagtagtgtttatcttttcttttcctt 21723611  T
Q  120 nnnnnnaatagttatatgatgtcacaggataaggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttcagtcctgga 219  Q
          ||||||||||||||||||||||| | ||||||||||||||||||| | |||||||||||| |||||| |||||||||||  |||||||||||||    
T  21723612 ttttttaatagttatatgatgtcacaggaca-ggggtaaccttcgcacaactggtaaagttgttgtcatgtgactggatggttacaagttcagtcctgga 21723710  T
Q  220 aacagtctcttgtgtaatggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtat 319  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||| |||||||||||| |||||    
T  21723711 aacagcctcttgtgtaatggaaacagcctcttgtataaaaatagggtaaggctgagtacaatacaccaaatggtagaaccttttcccggaccctgcgtat 21723810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 365 - 490
Target Start/End: Original strand, 21723811 - 21723936
Alignment:
Q  365 ggacaaaacttttcaacccttcaaataattttataccacaaagattctgtgatgtttcaaaatcaagagatatatatttaattttctcctatgagtactg 464  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  21723811 ggacaaaacttttcaacccttcaaataattttataccacaaagattctgtgatgtttcaaaatcaagatatatatatttaattttctcctatgagtactg 21723910  T
Q  465 acttatgttatttatctactagtata 490  Q
    ||||||||||||||||||||||||||    
T  21723911 acttatgttatttatctactagtata 21723936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 239 - 355
Target Start/End: Complemental strand, 35253297 - 35253181
Alignment:
Q  239 gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||||||||||||| |||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| |||||||||    
T  35253297 gaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc 35253199  T
Q  339 ggattg-cctttttatat 355  Q
    |||||| |||||||||||    
T  35253198 ggattgccctttttatat 35253181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 237 - 353
Target Start/End: Original strand, 27474325 - 27474441
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||| ||||||| |||||| |||| || ||||||||||||||||  |||| | ||||| ||||||||||||| |||||| | |||||||||||||    
T  27474325 tggaaacagtctcttgtgtaaaaacagggcaaagctgcgtacaatacactgaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 27474424  T
Q  337 ccggattgcctttttat 353  Q
    |||||||||| ||||||    
T  27474425 ccggattgcccttttat 27474441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 46248067 - 46247952
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||||| ||||||  |||||||| ||||||||||||||||||||| | ||||| ||||||||||||| |||||| | |||||||||||     
T  46248067 tggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgt 46247968  T
Q  336 accggattgccttttt 351  Q
    ||||| ||||| ||||    
T  46247967 accgggttgccctttt 46247952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 256 - 346
Target Start/End: Original strand, 4349702 - 4349792
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc 346  Q
    ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | ||||||||||||||||| |||||    
T  4349702 aaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 4349792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 236 - 345
Target Start/End: Complemental strand, 23768435 - 23768325
Alignment:
Q  236 atggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    |||||||||||||||||| ||||||  |||||||||||||||||||||||||||||| | ||||  |||||| |||||| |||||| | |||||||||||    
T  23768435 atggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggacaccttcccagaccctgcgtatgcgggagctttagtg 23768336  T
Q  335 caccggattgc 345  Q
    || ||||||||    
T  23768335 cagcggattgc 23768325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 46991848 - 46991958
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||| |||||||| ||||||  |||||||||||| |||||||||||| |||| | ||||| ||||||||||||| |||||||| ||||||||||||    
T  46991848 tggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgc 46991947  T
Q  336 accggattgcc 346  Q
    ||||| |||||    
T  46991948 accgggttgcc 46991958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 237 - 354
Target Start/End: Complemental strand, 34725210 - 34725094
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  |||||||||||||||||||||||| ||||| | ||||| ||||||||||||| | |||| | ||||| |||||||    
T  34725210 tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacactaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 34725112  T
Q  337 ccggattgcctttttata 354  Q
    |||| ||||| |||||||    
T  34725111 ccgggttgcccttttata 34725094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 6925144 - 6925259
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||| |||||||||| ||||| |||||||||||||||| |||||||||| |||| | ||||| |||||||| |||| |||||| | ||||||||||||    
T  6925144 tggaaatagcctcttgtgtaaaaaatagggtaaggctgcggacaatacaccgaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgc 6925243  T
Q  336 accggattgccttttt 351  Q
    ||||  ||||||||||    
T  6925244 accgagttgccttttt 6925259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 31382327 - 31382213
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||| ||| |||||||||||||||||||||||||| | ||||| ||||| ||||||| | |||| | |||||||| || |    
T  31382327 tggaaacagcctcttgtgtaaaaacaggataaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcatatgcgggagctttactgta 31382228  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||| ||||    
T  31382227 ccgggttgccctttt 31382213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 237 - 338
Target Start/End: Complemental strand, 32632670 - 32632569
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||  ||||| | |||| | |||||| ||||||    
T  32632670 tggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgca 32632571  T
Q  337 cc 338  Q
    ||    
T  32632570 cc 32632569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 18944687 - 18944805
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagc-tttag 332  Q
    ||||||||||||||||| ||||||  ||||||||||||||||||||||||||  |||| | ||||| ||||||||||||| |||||| | |||| |||||    
T  18944687 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaacaatggtgggaccccttcccggaccctgcgtatgcgggagcttttag 18944786  T
Q  333 tgcaccggattgccttttt 351  Q
    |||||||| ||||| ||||    
T  18944787 tgcaccgggttgccctttt 18944805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 256 - 351
Target Start/End: Complemental strand, 42304303 - 42304206
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    ||||| ||||||||| |||||||||||||| |||  || | ||||| ||||||||||||| |||||||| ||||||||||||||||||||||| ||||    
T  42304303 aaaaacagggtaaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgccctttt 42304206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 45402138 - 45402250
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggt--aagg-ctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| |||||| |||||  |||  ||||||||||||||||||||| | ||||| |||||| |||||| |||||| | ||||||||||    
T  45402138 tggaaacagcctcttgtgtaaaaacagggttcaagttctgcgtacaatacaccaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagt 45402237  T
Q  334 gcaccggattgcc 346  Q
    ||||||| |||||    
T  45402238 gcaccgggttgcc 45402250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 353
Target Start/End: Original strand, 10668269 - 10668388
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| ||||||  | ||||||| |||||||||||||||||  ||| | ||||| |||||||| |||| |||||| | ||||||||||    
T  10668269 tggaaacagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggtccctgcgtatgcgggagctttagt 10668368  T
Q  334 gcaccggattgcctttttat 353  Q
    ||||||| ||||| ||||||    
T  10668369 gcaccgggttgcccttttat 10668388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 14617082 - 14617186
Alignment:
Q  237 tggaaacagcctcttgtataaa-aatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||||| |||| || | ||||||| |||||||||||||||||||| | ||| | ||||||||||||| | |||| | ||||||||||||    
T  14617082 tggaaacagcctcttgtgtaaataacaaggtaaggttgcgtacaatacaccaaatggtgggatcccttcccggaccctgcatatgcgggagctttagtgc 14617181  T
Q  336 accgg 340  Q
    |||||    
T  14617182 accgg 14617186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 238 - 340
Target Start/End: Complemental strand, 18742073 - 18741967
Alignment:
Q  238 ggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    |||||||| || ||||||||||| |  |||||||||||||||||||||||||||  || | ||||| |||||| |||||| |||||| ||||||||||||    
T  18742073 ggaaacagtcttttgtataaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagt 18741974  T
Q  334 gcaccgg 340  Q
    |||||||    
T  18741973 gcaccgg 18741967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 320
Target Start/End: Complemental strand, 25468377 - 25468293
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatg 320  Q
    |||||||| |||||||| ||||||| ||||||||| |||||||||||||||||||| | |||||||||||| |||||| ||||||    
T  25468377 tggaaacaacctcttgtgtaaaaatcagggtaaggttgcgtacaatacaccaaatggttggacctcttcccagaccctgcgtatg 25468293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 353
Target Start/End: Complemental strand, 30395842 - 30395723
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| ||||||  ||||||||||||||||||||||||||  |||| | ||||| ||||||||||||  | |||| | ||||||||||    
T  30395842 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagt 30395743  T
Q  334 gcaccggattgcctttttat 353  Q
    ||||||  ||||| ||||||    
T  30395742 gcaccgagttgcccttttat 30395723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 240 - 352
Target Start/End: Original strand, 35005170 - 35005285
Alignment:
Q  240 aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||||||||| ||||||  ||||||||||||| ||||||||||||||  || | ||||| ||||||||||||| |||||| | | |||||||||||    
T  35005170 aaacagcctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggcgctttagtgca 35005269  T
Q  337 ccggattgccttttta 352  Q
    |||| ||||| |||||    
T  35005270 ccgggttgccctttta 35005285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 239 - 351
Target Start/End: Complemental strand, 38478392 - 38478281
Alignment:
Q  239 gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||||||||||||| |||||  |||||||||||||||||||||||||||||| | | ||| |||| |||||||| | |||| | ||||| |||||||||    
T  38478392 gaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtggaaccccttctcggaccctgcatatgcgggagctctagtgcacc 38478294  T
Q  339 ggattgccttttt 351  Q
    || ||||| ||||    
T  38478293 gggttgccctttt 38478281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 352
Target Start/End: Complemental strand, 41319920 - 41319804
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||| ||||||| ||||||  |||||||||||||||||||||||||||||||| ||||| ||||||| ||||| | |||| | ||| || |||||    
T  41319920 tggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatgatgggaccccttcccgaacccttcatatgcgggagtttcagtgc 41319821  T
Q  336 accggattgccttttta 352  Q
    || || ||||| |||||    
T  41319820 actgggttgccctttta 41319804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 239 - 330
Target Start/End: Original strand, 11596559 - 11596650
Alignment:
Q  239 gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttt 330  Q
    |||||| |||||||| |||||| |||||||||||||||| ||||||||||||| | ||||| ||||| ||||||| |||||| | |||||||    
T  11596559 gaaacaacctcttgtgtaaaaacagggtaaggctgcgtataatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttt 11596650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 237 - 330
Target Start/End: Complemental strand, 18724659 - 18724565
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttt 330  Q
    ||||||||||||||||| ||||||  |||||||||||| ||||||||||||||||  | ||||| ||||||||||||||| |||| | |||||||    
T  18724659 tggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaaatcttgggaccccttcccggaccctacatatgcgggagcttt 18724565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 19974188 - 19974087
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||||||||  || ||||||||||| |||| ||||||||||||||| ||||||| |||||  ||||||||| ||| ||||| | ||||||||||||    
T  19974188 tggaaacagcctcaagtgtaaaaatagggcaaggttgcgtacaatacaccaaaatgatgggacccattcccggactctatgtatgcgggagctttagtgc 19974089  T
Q  336 ac 337  Q
    ||    
T  19974088 ac 19974087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 12126949 - 12126850
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||||| |||||| |||||  |||||||||||||||||||||||||||||  | ||||| ||||||||||||| | |||| | ||||| |||||||    
T  12126949 tggaaacagcttcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaattgtgggaccccttcccggaccctgcatatgcgggagctgtagtgca 12126851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 245 - 317
Target Start/End: Complemental strand, 21910754 - 21910682
Alignment:
Q  245 gcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgt 317  Q
    ||||||| | |||||||||||||||| |||||||||||||||||||| | ||||| ||||||| |||||||||    
T  21910754 gcctcttatgtaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctacgt 21910682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 264 - 340
Target Start/End: Complemental strand, 44485195 - 44485120
Alignment:
Q  264 ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    |||||||||||||||||||||||||||| | ||||| ||||||||| |||||||||| | ||||||| |||||||||    
T  44485195 ggtaaggctgcgtacaatacaccaaatggttggaccccttcccggatcctacgtatgcgggagcttt-gtgcaccgg 44485120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 264 - 351
Target Start/End: Original strand, 8197115 - 8197202
Alignment:
Q  264 ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    ||||||||| |||||| ||||||||||| ||||||| |||| |||||||| |||||||  ||||||||||| ||||| ||||| ||||    
T  8197115 ggtaaggctacgtacagtacaccaaatggtaggaccccttctcggaccctgcgtatgttggagctttagtgtaccgggttgccctttt 8197202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 257 - 340
Target Start/End: Complemental strand, 10378828 - 10378745
Alignment:
Q  257 aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    |||| |||||||||||||||||||||||||||||| | ||||| ||||  ||||||| | |||| | |||||||||||||||||    
T  10378828 aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgg 10378745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 257 - 352
Target Start/End: Original strand, 19414502 - 19414597
Alignment:
Q  257 aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttta 352  Q
    |||| ||| |||||||||||||||||||||||||| | ||||| ||||||| ||||| | |||| | ||||| ||||||||||| ||||| |||||    
T  19414502 aaaacaggttaaggctgcgtacaatacaccaaatggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgccctttta 19414597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 336
Target Start/End: Original strand, 27201691 - 27201793
Alignment:
Q  237 tggaaacagcctcttgtataa-aaatagggtaaggctgcgtacaatacacc--aaatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| | | ||| |||||||||||||||||||||||||  ||||| | ||||| ||||||||||| | |||||| | ||||||||||    
T  27201691 tggaaacagcctcttgtgtcagaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccttgcgtatgcgggagctttagt 27201790  T
Q  334 gca 336  Q
    |||    
T  27201791 gca 27201793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 240 - 351
Target Start/End: Complemental strand, 45812646 - 45812536
Alignment:
Q  240 aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg 339  Q
    |||||| ||||||| |||||  ||||||||||||| |||||||||||||||| | ||||| ||||||  ||||| | |||| | ||||| ||||||||||    
T  45812646 aaacagtctcttgtgtaaaag-agggtaaggctgcatacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccg 45812548  T
Q  340 gattgccttttt 351  Q
    | ||||||||||    
T  45812547 ggttgccttttt 45812536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 237 - 341
Target Start/End: Complemental strand, 2435901 - 2435795
Alignment:
Q  237 tggaaacagcctcttgtat-aaaaatagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    ||||||||||||| ||| | |||||||||||||| |||||||||||||||| ||||| | ||||| ||| ||| ||||| || ||| | |||||||||||    
T  2435901 tggaaacagcctcctgtgtgaaaaatagggtaagcctgcgtacaatacaccaaaatggtgggacccctttccgtaccctccgcatgcgggagctttagtg 2435802  T
Q  335 caccgga 341  Q
    |||||||    
T  2435801 caccgga 2435795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 237 - 343
Target Start/End: Original strand, 47214555 - 47214660
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||| ||||||| |||||  ||||||||| |||||||||||||||||||| | ||||| |||||| |||||| | |||| | ||||| |||||||    
T  47214555 tggaaacagtctcttgtttaaaac-agggtaaggttgcgtacaatacaccaaatggtgggaccccttcccagaccctgcatatgcgggagctctagtgca 47214653  T
Q  337 ccggatt 343  Q
    || ||||    
T  47214654 ccagatt 47214660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 262 - 351
Target Start/End: Original strand, 15505634 - 15505722
Alignment:
Q  262 agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    |||||||| ||||||||||||||||||||| | ||||| ||||||| ||||| |||||| | ||||||| |||||||| | |||||||||    
T  15505634 agggtaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagcttt-gtgcaccgaactgccttttt 15505722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 240 - 340
Target Start/End: Original strand, 35019277 - 35019377
Alignment:
Q  240 aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||| |||||||||||||||| ||  ||||||||| ||||||||||||| || | ||||| || ||| |||||| |||||| |||||||||||||||||    
T  35019277 aaacaacctcttgtataaaaatcagtataaggctgcatacaatacaccaattggtgggacccct-cccagaccctgcgtatgcgagagctttagtgcacc 35019375  T
Q  339 gg 340  Q
    ||    
T  35019376 gg 35019377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 15511265 - 15511158
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcg--tacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttag 332  Q
    ||||||| ||||||||| ||||||  ||||||||||||||  |||||||||||||| || | | ||| ||||| ||||||| |||||||| |||||||||    
T  15511265 tggaaaccgcctcttgtgtaaaaaacagggtaaggctgcggatacaatacaccaaaatggtggtaccccttcctggaccctgcgtatgtgtgagctttag 15511166  T
Q  333 tgcaccgg 340  Q
    ||||||||    
T  15511165 tgcaccgg 15511158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 353
Target Start/End: Complemental strand, 20004206 - 20004087
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    |||||||||||||| || ||||||  | ||||||||||||||||||||||||  |||| | ||||| |||||| |||||  | |||| | ||||||||||    
T  20004206 tggaaacagcctctcgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagt 20004107  T
Q  334 gcaccggattgcctttttat 353  Q
    ||||||| ||||| ||||||    
T  20004106 gcaccgggttgcccttttat 20004087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 289
Target Start/End: Original strand, 22324937 - 22324989
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaa 289  Q
    ||||||||||||||||| |||||| ||||||||||||| ||||||||||||||    
T  22324937 tggaaacagcctcttgtgtaaaaacagggtaaggctgcatacaatacaccaaa 22324989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 23796509 - 23796613
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||||| ||||||| |  |||||| |||||||||||||||||||| |  |||| |||||| |||||| | ||||   ||||||||||||    
T  23796509 tggaaacagcctcttgtgtaaaaatcaatgtaaggttgcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgctggagctttagtgc 23796608  T
Q  336 accgg 340  Q
    |||||    
T  23796609 accgg 23796613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 35117882 - 35117775
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacacc--aaatgataggacctcttcccggaccctacgt-atgtgagagctttag 332  Q
    |||||| |||||||||| ||||| | |||||||||||| ||||||||||||  ||||||| ||||| ||||||||||||| ||| |||   |||||||||    
T  35117882 tggaaatagcctcttgtgtaaaatacagggtaaggctgtgtacaatacaccaaaaatgatgggaccccttcccggaccctgcgtaatgcaggagctttag 35117783  T
Q  333 tgcaccgg 340  Q
    ||||||||    
T  35117782 tgcaccgg 35117775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 251 - 340
Target Start/End: Complemental strand, 31442489 - 31442399
Alignment:
Q  251 tgtataaaaatagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    |||| ||||| ||||||||| ||||||||||||||| ||||| | ||||| |||||||||| ||  ||||||| ||||||| |||||||||    
T  31442489 tgtaaaaaaacagggtaaggatgcgtacaatacaccaaaatggtgggaccccttcccggacactgtgtatgtgggagctttggtgcaccgg 31442399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 34725276 - 34725190
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| |||||||||||    
T  34725276 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 34725190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 45812715 - 45812629
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| |||||||||||||| |||||| || | ||| || ||||| ||||||| ||||||||||||||||||    
T  45812715 aggggtaaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctgaaaacagtctcttgtgtaa 45812629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 351
Target Start/End: Complemental strand, 1517395 - 1517310
Alignment:
Q  266 taaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    ||||||||||||||||||||||| || | ||||| |||| | |||||| ||||||   ||||||||||||||||| ||||| ||||    
T  1517395 taaggctgcgtacaatacaccaattggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgccctttt 1517310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 256 - 338
Target Start/End: Complemental strand, 19932849 - 19932765
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacacc--aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||| |||||||||||||||||||||||||  ||||| | ||||| ||||||||||||| ||||||  ||| | ||||||||||    
T  19932849 aaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcacc 19932765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 340
Target Start/End: Complemental strand, 20999933 - 20999860
Alignment:
Q  267 aaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    ||||||||||||||||||||||||||| || || ||||| | ||||| |||| | | |||||||||||||||||    
T  20999933 aaggctgcgtacaatacaccaaatgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccgg 20999860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 236 - 289
Target Start/End: Original strand, 33223027 - 33223080
Alignment:
Q  236 atggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaa 289  Q
    |||||||||||||||||| |||||| |||| |||| ||||||||||||||||||    
T  33223027 atggaaacagcctcttgtgtaaaaacagggaaaggttgcgtacaatacaccaaa 33223080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 256 - 336
Target Start/End: Original strand, 43207559 - 43207640
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaat-gataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||| |||||||| | || ||||||||||||||| | | |||||||||||| ||||||| ||||| |||||||||||||||    
T  43207559 aaaaacagggtaagacggcatacaatacaccaaattggtgggacctcttcccagaccctatgtatgcgagagctttagtgca 43207640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 237 - 353
Target Start/End: Complemental strand, 6983923 - 6983808
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||| | || ||||| ||||||||  |||||||||||||||||||| | ||||| ||| ||||||||| |||| |   ||||||| |||||    
T  6983923 tggaaacagcctcgtata-aaaaacagggtaagtatgcgtacaatacaccaaatggtgggacccctttccggaccctgcgtaggcaggagctttggtgca 6983825  T
Q  337 ccggattgcctttttat 353  Q
    ||||  |||| ||||||    
T  6983824 ccgggctgcccttttat 6983808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 239 - 289
Target Start/End: Complemental strand, 17470458 - 17470407
Alignment:
Q  239 gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa 289  Q
    ||||||||||||||| ||||||  ||||||||||||||||||||||||||||    
T  17470458 gaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaa 17470407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 14617016 - 14617102
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| ||| |||| |||||||||||||| |||||||||||    
T  14617016 aggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacagcctcttgtgtaa 14617102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 20004272 - 20004186
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| |  |||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||| |||| ||||||    
T  20004272 aggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctctcgtgtaa 20004186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 27474259 - 27474345
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| || ||||| |||| |||||||||||||||||||||    
T  27474259 aggggtaaccttagctcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcttggaaacagtctcttgtgtaa 27474345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 32632736 - 32632650
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| || ||| || | ||| ||||||||| ||||||||||||| |||||||||||    
T  32632736 aggggtaaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 32632650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 41319986 - 41319900
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||||||  |||||| | |||||||||||| |||||| || | ||| || |||| | |||||||||||||||||||||||||    
T  41319986 aggggtaaccttgacacaactggtaaagttgttgtcatgtgactgaaaggtcacaggtttaagtcctggaaacagtctcttgtgtaa 41319900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 262 - 340
Target Start/End: Original strand, 43768209 - 43768287
Alignment:
Q  262 agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    ||||||||||||| ||||||||||||| || | ||||| |||||| |||||| |||||  | |||||||| ||||||||    
T  43768209 agggtaaggctgcctacaatacaccaattggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgg 43768287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 155 - 236
Target Start/End: Original strand, 45402077 - 45402158
Alignment:
Q  155 gtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||| || |||| | |||||||||||| ||||||| ||| ||| ||||||||| ||||||||||||| |||||||||||    
T  45402077 gtaaccttggcgcaactggtaaagttgttgtcatgtgat-ggaaggtaacgggttcaagtcctggaaacagcctcttgtgtaa 45402158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 46991782 - 46991868
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| |  |||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||  |||||||||||    
T  46991782 aggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaa 46991868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 232
Target Start/End: Original strand, 47214489 - 47214571
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgt 232  Q
    ||||||||| || || |||| | |||||||||||| |||||| || | ||| ||||||||| |||||||||||||||||||||    
T  47214489 aggggtaactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgt 47214571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 251 - 320
Target Start/End: Complemental strand, 20982849 - 20982780
Alignment:
Q  251 tgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatg 320  Q
    |||| |||||||||||||||||||  |||||||||| |||| | ||| |||||| |||||||| ||||||    
T  20982849 tgtaaaaaaatagggtaaggctgccaacaatacacctaatggtgggatctcttctcggaccctgcgtatg 20982780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 239 - 340
Target Start/End: Original strand, 23371170 - 23371270
Alignment:
Q  239 gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||||||| ||||  ||||||  ||| |||| || ||||||||||||||||| | ||||| ||| || |||||| ||||||||  ||||||||||||||    
T  23371170 gaaacagccacttgggtaaaaaacgggcaaggttgtgtacaatacaccaaatgctgggacccctt-ccagaccctgcgtatgtggtagctttagtgcacc 23371268  T
Q  339 gg 340  Q
    ||    
T  23371269 gg 23371270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 313
Target Start/End: Complemental strand, 34149074 - 34148997
Alignment:
Q  237 tggaaacagcctcttgtata-aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct 313  Q
    ||||||||||||||||| || |||||||||||||| ||||||||| | |||||||| |  |||| ||||| |||||||    
T  34149074 tggaaacagcctcttgtgtagaaaatagggtaaggttgcgtacaaaagaccaaatggtgagaccccttcctggaccct 34148997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 151 - 227
Target Start/End: Original strand, 34714601 - 34714678
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtct 227  Q
    |||||||||||| || |||| | |||||||||||| ||||||||| | ||| |||||||| |||| ||||||||||||    
T  34714601 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgattgaaaggtcacgggttcaagtcatggaaacagtct 34714678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 240 - 338
Target Start/End: Original strand, 19701617 - 19701717
Alignment:
Q  240 aaacagcctcttgtataaaaatag-ggtaaggctgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtgcac 337  Q
    |||||||||||||| ||||||    ||||||| || ||||||||||||||| || | || || ||||||||||||| |||||| | ||||||||||||||    
T  19701617 aaacagcctcttgtgtaaaaaacttggtaaggatgggtacaatacaccaaaatggtggggccccttcccggaccctgcgtatgcgggagctttagtgcac 19701716  T
Q  338 c 338  Q
    |    
T  19701717 c 19701717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 237 - 313
Target Start/End: Complemental strand, 22930181 - 22930106
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct 313  Q
    |||||||||||| |||| |||||| ||||||||| || | ||||||||||||||| | ||||| ||||| |||||||    
T  22930181 tggaaacagccttttgtgtaaaaacagggtaaggttgtg-acaatacaccaaatggtgggaccccttcctggaccct 22930106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Original strand, 6925101 - 6925164
Alignment:
Q  174 taaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| |||||| |||| ||| |||||||| ||||||||||| || |||||||||||    
T  6925101 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaa 6925164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 299
Target Start/End: Complemental strand, 18335402 - 18335339
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacc 299  Q
    ||||||||| ||||||| ||||||| ||||||| | ||||||||||||| |||||||| |||||    
T  18335402 tggaaacagtctcttgtttaaaaattagggtaaagttgcgtacaatacatcaaatgatgggacc 18335339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Complemental strand, 18724702 - 18724639
Alignment:
Q  174 taaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| |||||| || | ||| ||||||||| ||||||||||||| |||||||||||    
T  18724702 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 18724639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 18944621 - 18944707
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| || ||||| || ||||||||||| |||||||||||    
T  18944621 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaaggcctggaaacagcctcttgtgtaa 18944707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 22930247 - 22930161
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| | |||||| |||||||||||||| || ||||||||    
T  22930247 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagccttttgtgtaa 22930161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 156 - 236
Target Start/End: Complemental strand, 30395903 - 30395822
Alignment:
Q  156 taaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    ||||||| || |||| | |||||||||||| |||||| |  | ||| ||||||||| ||||||||||||| |||||||||||    
T  30395903 taaccttggcgcaactggtaaagttgttgtcatgtgactttaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 30395822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 295 - 340
Target Start/End: Original strand, 30555218 - 30555263
Alignment:
Q  295 ggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    ||||| |||| |||||||| |||||| |||||||||||||||||||    
T  30555218 ggaccccttcacggaccctgcgtatgcgagagctttagtgcaccgg 30555263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 39215073 - 39214968
Alignment:
Q  237 tggaaacagcctcttgtataaaaata-gggtaaggctgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    |||||||| |||||||| ||||||   ||||||||||||||||||||  ||||| || | || || ||||||  ||||| ||||||||  ||||||||||    
T  39215073 tggaaacaacctcttgtgtaaaaaactgggtaaggctgcgtacaatattccaaaatggtgggtccccttcccaaaccctgcgtatgtggaagctttagtg 39214974  T
Q  335 caccgg 340  Q
    ||||||    
T  39214973 caccgg 39214968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 9939505 - 9939612
Alignment:
Q  237 tggaaacagcctcttgtataa-aaatagggtaaggctgcgtacaatacaccaaa--tgataggacctc-ttcccggaccctacgtatgtgagagctttag 332  Q
    |||||||| |||||||| ||| ||| | ||||||| ||||| ||||||||||||  || | ||||| | ||| |||||||| |||||| | |||||||||    
T  9939505 tggaaacaacctcttgtttaagaaacatggtaaggttgcgtgcaatacaccaaaaatggtgggacccccttctcggaccctgcgtatgcgggagctttag 9939604  T
Q  333 tgcaccgg 340  Q
    ||||||||    
T  9939605 tgcaccgg 9939612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 338
Target Start/End: Complemental strand, 28894642 - 28894570
Alignment:
Q  266 taaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||| ||||||||||||| |||||| ||  ||| |||||  |||||| | |||| |||||||||||||||||    
T  28894642 taaggttgcgtacaatacatcaaatggtaaaaccccttcctagaccctgcatatgcgagagctttagtgcacc 28894570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 306 - 350
Target Start/End: Original strand, 50548561 - 50548605
Alignment:
Q  306 cggaccctacgtatgtgagagctttagtgcaccggattgcctttt 350  Q
    ||||||||||||||| | |||||||||| ||||| ||||||||||    
T  50548561 cggaccctacgtatgcgggagctttagtacaccgaattgcctttt 50548605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 295 - 351
Target Start/End: Original strand, 50606506 - 50606562
Alignment:
Q  295 ggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    ||||| ||||||||||||| | |||| | ||||||||||||||||| ||||| ||||    
T  50606506 ggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt 50606562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 337
Target Start/End: Original strand, 50811983 - 50812085
Alignment:
Q  237 tggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    |||||||||| |||||| |||||| |  |||||||| ||||||||||||||| ||||| | ||||| |||||||  |||| |||||| | |||||||| |    
T  50811983 tggaaacagcttcttgtgtaaaaaaacagggtaaggttgcgtacaatacaccaaaatggt-ggaccccttcccgcgccctgcgtatgcgggagctttaat 50812081  T
Q  334 gcac 337  Q
    ||||    
T  50812082 gcac 50812085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 71; Significance: 6e-32; HSPs: 75)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 236 - 346
Target Start/End: Complemental strand, 6430740 - 6430630
Alignment:
Q  236 atggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | ||||||||| ||    
T  6430740 atggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccacttcccggaccctgcgtatgcgggagctttagcgc 6430641  T
Q  336 accggattgcc 346  Q
    ||||| |||||    
T  6430640 accgggttgcc 6430630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 5648280 - 5648394
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | |||||| ||||||    
T  5648280 tggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgca 5648379  T
Q  337 ccggattgccttttt 351  Q
    | || ||||| ||||    
T  5648380 ctgggttgccctttt 5648394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 40915850 - 40915959
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||| | |||||||||||||||||||||||||||| | ||| | ||||||||||||| |||||| | |||||| ||||||    
T  40915850 tggaaacagcctcttgtgtaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgca 40915949  T
Q  337 ccggattgcc 346  Q
    ||||||||||    
T  40915950 ccggattgcc 40915959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 25629070 - 25629185
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||| ||||||| ||||| |||||||||||||| ||||||||||||||||| | ||||| ||||||||||||||| |||| | ||||||||||||    
T  25629070 tggaaacagtctcttgtgtaaaaaatagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctacatatgcgggagctttagtgc 25629169  T
Q  336 accggattgccttttt 351  Q
    ||||| ||||| ||||    
T  25629170 accgggttgccctttt 25629185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 20639773 - 20639657
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    ||||||||||||||||| ||||||  |||||||||||||||||||||||||||| || | ||||| ||||||||||||| |||||| | |||||||||||    
T  20639773 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg 20639674  T
Q  335 caccggattgccttttt 351  Q
    |||||| ||||| ||||    
T  20639673 caccgggttgccctttt 20639657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 30639401 - 30639515
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||| ||||||| |||||| |||||||||||||||||||||||||||||| |  |||| ||||||||||||| | |||| | |||||||||||||    
T  30639401 tggaaacagactcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgagaccccttcccggaccctgcatatgcgggagctttagtgca 30639500  T
Q  337 ccggattgccttttt 351  Q
    | || ||||| ||||    
T  30639501 ctgggttgccctttt 30639515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 47528642 - 47528529
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  |||||||||||||||||||||||||||||| | ||||| |||||||||||||   |||||| ||||| |||||||    
T  47528642 tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgaatatgtgggagctctagtgca 47528544  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||| ||||    
T  47528543 ccgggttgccctttt 47528529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 237 - 322
Target Start/End: Complemental strand, 5306777 - 5306692
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtg 322  Q
    ||||||||||||||||| |||||  ||||||||| |||||||||||||||||||| | ||||| ||||||||||||| ||||||||    
T  5306777 tggaaacagcctcttgtgtaaaatcagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgtg 5306692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 20225005 - 20225113
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||| |||||||| |||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| |||||||    
T  20225005 tggaaacaacctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 20225103  T
Q  337 ccggattgcc 346  Q
    |||| |||||    
T  20225104 ccgggttgcc 20225113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 240 - 352
Target Start/End: Complemental strand, 51865149 - 51865036
Alignment:
Q  240 aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    |||||||||||||| ||||||  | |||||||||||||||||||||||||||| | || || ||||||||||||| |||||| | |||||||| ||||||    
T  51865149 aaacagcctcttgtgtaaaaaacatggtaaggctgcgtacaatacaccaaatggtggggccccttcccggaccctgcgtatgcgggagctttattgcacc 51865050  T
Q  339 ggattgccttttta 352  Q
    ||| |||| |||||    
T  51865049 ggactgccctttta 51865036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 7909394 - 7909284
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatg-tgagagctttagtgc 335  Q
    ||||||||| ||||||| |||||| ||||||||| |||||||||||||||||||| | ||||| ||||||| ||||| ||||||  | ||||||||||||    
T  7909394 tggaaacagtctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcggggagctttagtgc 7909295  T
Q  336 accggattgcc 346  Q
    | ||| |||||    
T  7909294 atcgggttgcc 7909284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 48598937 - 48598824
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||| | | ||||   ||||| |||||||    
T  48598937 tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccatgcatatgccggagctctagtgca 48598839  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||| ||||    
T  48598838 ccgggttgccctttt 48598824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 240 - 340
Target Start/End: Original strand, 54175088 - 54175190
Alignment:
Q  240 aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacacc-aaatgataggacctctt-cccggaccctacgtatgtgagagctttagtgcac 337  Q
    |||||||||||||| |||||| ||||||||||||||||||||||||| ||||| | ||||| ||| |||||||||| | |||| | ||||||||||||||    
T  54175088 aaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttccccggaccctgcatatgcgggagctttagtgcac 54175187  T
Q  338 cgg 340  Q
    |||    
T  54175188 cgg 54175190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 257 - 346
Target Start/End: Complemental strand, 29207991 - 29207902
Alignment:
Q  257 aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc 346  Q
    |||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||||||| |||||    
T  29207991 aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 29207902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 239 - 334
Target Start/End: Original strand, 14983857 - 14983953
Alignment:
Q  239 gaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    ||||||||||||||| ||||| ||||||||||| ||| |||||||||| ||||| | ||||| ||||||||||||| |||||| | |||||||||||    
T  14983857 gaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg 14983953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 329
Target Start/End: Original strand, 49796819 - 49796911
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctt 329  Q
    ||||||||||||||||| | |||| | |||||||||||||||||||||||||||| | ||||| ||||||| ||||| |||||| | ||||||    
T  49796819 tggaaacagcctcttgtgttaaaacatggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctt 49796911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 240 - 351
Target Start/End: Complemental strand, 9832422 - 9832312
Alignment:
Q  240 aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg 339  Q
    |||||||||||||| |||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | ||||   || || ||||||||||    
T  9832422 aaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcaggaactctagtgcaccg 9832324  T
Q  340 gattgccttttt 351  Q
    | ||||| ||||    
T  9832323 ggttgccctttt 9832312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 47443978 - 47444093
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||||  ||||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | ||||   |||||| |||||    
T  47443978 tggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcaggagcttcagtgc 47444077  T
Q  336 accggattgccttttt 351  Q
    || || ||||| ||||    
T  47444078 actgggttgccctttt 47444093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 239 - 353
Target Start/End: Original strand, 16911585 - 16911702
Alignment:
Q  239 gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||| || |||| ||||||||||||||||||||||||||  |||| | ||||| ||||||||||||| |||| | | ||||||||||      
T  16911585 gaaacagcctcttgtgtacaaatcagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtacgcgggagctttagttt 16911684  T
Q  336 accggattgcctttttat 353  Q
    ||||| ||||| ||||||    
T  16911685 accgggttgcccttttat 16911702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 256 - 338
Target Start/End: Complemental strand, 30690270 - 30690188
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||| ||||||||||||| ||||||||||||| || | ||||| ||||||||||||| |||||| | |||||||||||||||    
T  30690270 aaaaacagggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcacc 30690188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 39077908 - 39077795
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  ||||||||| ||||||||||| |||||||| |  ||| |||| ||||||||| | |||| | ||||| |||||||    
T  39077908 tggaaacagcctcttgtgtaaaac-agggtaaggttgcgtacaatataccaaatggtgagacatctttccggaccctgcatatgcgggagctctagtgca 39077810  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||||||||    
T  39077809 ccgggttgccttttt 39077795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 239 - 339
Target Start/End: Original strand, 54730272 - 54730376
Alignment:
Q  239 gaaacagcctcttgtataaaaa--tagggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    ||||||||||||||| ||||||  |||| |||||||||||| ||||||||||  ||||| | ||| ||||||||||||| |||||| | |||||||||||    
T  54730272 gaaacagcctcttgtgtaaaaaaataggataaggctgcgtataatacaccaataatgatggaaccccttcccggaccctgcgtatgcgggagctttagtg 54730371  T
Q  335 caccg 339  Q
    |||||    
T  54730372 caccg 54730376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 313
Target Start/End: Complemental strand, 17043508 - 17043431
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct 313  Q
    ||||||||||||||||| ||||| | |||||||||||||||||||||||||||||| | ||||| |||||| ||||||    
T  17043508 tggaaacagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccagaccct 17043431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 256 - 341
Target Start/End: Original strand, 19027889 - 19027974
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgga 341  Q
    ||||| ||||||||||||||||||||||||||| || | ||||| ||| || ||| || |||||||| ||||||||||||||||||    
T  19027889 aaaaacagggtaaggctgcgtacaatacaccaattggtgggacccctttccagactctgcgtatgtgggagctttagtgcaccgga 19027974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 21646985 - 21647097
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||  |||| | ||||| |||||| |||||  | |||| | ||||||||||    
T  21646985 tggaaacagcctcttgtgtaaaaaatagggtaaggctgcgtacaatataccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagt 21647084  T
Q  334 gcaccggattgcc 346  Q
    ||||||| |||||    
T  21647085 gcaccgggttgcc 21647097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 242 - 351
Target Start/End: Original strand, 23501813 - 23501925
Alignment:
Q  242 acagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    |||||||||||| ||||||  ||||||||| |||||||||||||||||  ||| | ||||| ||||||||||||| | |||| | |||||||||||||||    
T  23501813 acagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 23501912  T
Q  339 ggattgccttttt 351  Q
    || ||||| ||||    
T  23501913 gggttgccctttt 23501925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 239 - 351
Target Start/End: Complemental strand, 10277867 - 10277756
Alignment:
Q  239 gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||||||||||||||||||| |||| |||||||||||||||||||||||||| |   ||| |||||| |||||| | |||| | ||| | ||||| |||    
T  10277867 gaaacagcctcttgtataaaa-taggataaggctgcgtacaatacaccaaatggtgaaaccccttcccagaccctgcatatgcgggagttctagtgaacc 10277769  T
Q  339 ggattgccttttt 351  Q
    |||||||| ||||    
T  10277768 ggattgccctttt 10277756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 35567191 - 35567295
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||| ||||| ||||||  |||||||||||| |||||| |||||||||| | ||||| ||||||| ||||| ||| || | ||||||||||||    
T  35567191 tggaaacagccacttgtgtaaaaaacagggtaaggctgtgtacaacacaccaaatggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgc 35567290  T
Q  336 accgg 340  Q
    |||||    
T  35567291 accgg 35567295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 9987948 - 9987833
Alignment:
Q  237 tggaaacagcctcttgtataaa-aatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||| |||||||| |||| |||||||||||||||| |||||||||||||||| | ||||| |||||  |||| | | |||| | |||||||| |||    
T  9987948 tggaaacaacctcttgtgtaaacaatagggtaaggctgcatacaatacaccaaatggtgggaccccttccttgaccttgcatatgcgggagctttaatgc 9987849  T
Q  336 accggattgccttttt 351  Q
    |||||  |||||||||    
T  9987848 accgggctgccttttt 9987833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 16408717 - 16408600
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| ||||||  |||||||| |||||||||||||||||  |||| | | ||| ||||||||||||  | |||| | ||||||||||    
T  16408717 tggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaataatggtggaaccccttcccggaccccgcatatgcgggagctttagt 16408618  T
Q  334 gcaccggattgccttttt 351  Q
    ||||||| ||||| ||||    
T  16408617 gcaccgggttgccctttt 16408600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 41018907 - 41018807
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||| |||||||| ||||| |||||||||||| |||||||||||||||||  | ||||| |||||| |||| | ||||||   | |||||||||||    
T  41018907 tggaaacaacctcttgtgtaaaattagggtaaggctacgtacaatacaccaaatagtgggaccccttcccagaccttgcgtatggaggggctttagtgca 41018808  T
Q  337 c 337  Q
    |    
T  41018807 c 41018807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 264 - 351
Target Start/End: Complemental strand, 3580926 - 3580840
Alignment:
Q  264 ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    |||||||||| || |||||||||||||| ||||||| ||||||||||||| | |||||| ||||||| |||||| ||| |||| ||||    
T  3580926 ggtaaggctgtgtgcaatacaccaaatgctaggaccccttcccggaccctgcatatgtgggagcttt-gtgcacgggactgccatttt 3580840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 240 - 351
Target Start/End: Complemental strand, 11054257 - 11054147
Alignment:
Q  240 aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg 339  Q
    |||||| ||||||| |||||  |||||||| |||||||||||||||||||||   | ||| ||||||||||||| | |||| | ||||| ||||||||||    
T  11054257 aaacagtctcttgtgtaaaac-agggtaagactgcgtacaatacaccaaatggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccg 11054159  T
Q  340 gattgccttttt 351  Q
    | ||||| ||||    
T  11054158 ggttgccctttt 11054147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 262 - 346
Target Start/End: Original strand, 20225121 - 20225207
Alignment:
Q  262 agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc 346  Q
    ||||||||||||||||||||||||||  |||| | ||||| ||||||||||||  | |||| | ||||||||||||||||| |||||    
T  20225121 agggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcc 20225207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 239 - 313
Target Start/End: Complemental strand, 47441642 - 47441567
Alignment:
Q  239 gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct 313  Q
    ||||||| ||||| | ||||||| |||||||||||| ||||||||||||||||| | ||||| |||||||||||||    
T  47441642 gaaacagtctcttttgtaaaaatcagggtaaggctgtgtacaatacaccaaatggttggaccccttcccggaccct 47441567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 146 - 236
Target Start/End: Complemental strand, 48599008 - 48598917
Alignment:
Q  146 ggataaggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||| |||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| |||||||||||    
T  48599008 ggatgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 48598917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 55766579 - 55766476
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||||  |||||| |  ||| ||||||||||||||||||||||||  |||| | | ||| | ||||||||| | |||||| |||||||||||||||    
T  55766579 tggaaacagtttcttgtgtgtaaacagggtaaggctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgca 55766480  T
Q  337 ccgg 340  Q
    ||||    
T  55766479 ccgg 55766476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 5648214 - 5648300
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| |||||||||||    
T  5648214 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 5648300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 264 - 337
Target Start/End: Complemental strand, 20908723 - 20908649
Alignment:
Q  264 ggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac 337  Q
    ||||||||||||||||||||||| ||||| | ||||| ||||||| ||||| |||||| | ||||||||||||||    
T  20908723 ggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac 20908649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 240 - 346
Target Start/End: Complemental strand, 44363243 - 44363134
Alignment:
Q  240 aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||||| ||| ||||||  |||||| ||||||||||||  |||||||  || | ||||| ||||||||||||| |||||| | |||||||||||||    
T  44363243 aaacagcctcgtgtgtaaaaaacagggtagggctgcgtacaacgcaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 44363144  T
Q  337 ccggattgcc 346  Q
    |||| |||||    
T  44363143 ccgggttgcc 44363134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 338
Target Start/End: Complemental strand, 55830834 - 55830733
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||| ||||||| |  ||| ||||||| ||||||||||||||||  |||| | | ||| | ||||||||| | |||||| |||||||||||||||    
T  55830834 tggaaacagtctcttgtgtgtaaacagggtaatgctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgca 55830735  T
Q  337 cc 338  Q
    ||    
T  55830734 cc 55830733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 236
Target Start/End: Complemental strand, 16408777 - 16408697
Alignment:
Q  157 aaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||| |||||||||||    
T  16408777 aaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 16408697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 8473734 - 8473624
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctctt-cccgga-ccctacgtatgtgagagctttagtg 334  Q
    ||||||||||||||||| |  ||  ||||||||||||| |||||||||||||||| | ||||| ||| |||||| |||| | |||| | |||||||||||    
T  8473734 tggaaacagcctcttgtgtttaac-agggtaaggctgcatacaatacaccaaatggtgggaccccttccccggacccctgcatatgcgggagctttagtg 8473636  T
Q  335 caccggattgcc 346  Q
    |||||| |||||    
T  8473635 caccgggttgcc 8473624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 236 - 339
Target Start/End: Complemental strand, 30496435 - 30496333
Alignment:
Q  236 atggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||||||||||||| |||| |  |||||||||||| ||||||||||||||||   ||||  ||||||||||| | | ||||   ||||||||||||    
T  30496435 atggaaacagcctcttgtgtaaacac-gggtaaggctgcatacaatacaccaaatggggggactccttcccggaccgtgcttatgatggagctttagtgc 30496337  T
Q  336 accg 339  Q
    ||||    
T  30496336 accg 30496333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 5306843 - 5306757
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||| ||| |||||| || | ||| ||||||||| ||||||||||||| |||||||||||    
T  5306843 aggggtaaccttggcgcaactggtaaagttgatgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 5306757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 11054326 - 11054240
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||| || || |||| | |||||||||||| |||||| || | ||| ||||||||| |||||| ||||||||||||||||||    
T  11054326 aggggtaactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctgaaaacagtctcttgtgtaa 11054240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 21646919 - 21647005
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||| ||||||| || |||| | |||||||||||| |||||| |||| ||| || |||||| ||||||||||||| |||||||||||    
T  21646919 agggataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacagcctcttgtgtaa 21647005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 313
Target Start/End: Complemental strand, 7385590 - 7385513
Alignment:
Q  237 tggaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct 313  Q
    ||||||||||||| ||| |||||| |||||||||| || || |||||||||||||| | |||||  ||||||||||||    
T  7385590 tggaaacagcctcatgtgtaaaaaatagggtaaggttgtgtgcaatacaccaaatggtgggaccctttcccggaccct 7385513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 256 - 338
Target Start/End: Original strand, 25343228 - 25343312
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaat--gataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||| ||||||||||||||||||||||||||||   | | ||||| |||||  || ||| |||||||||||||||||| |||||    
T  25343228 aaaaacagggtaaggctgcgtacaatacaccaaaaagggttggaccccttcctagatcctgcgtatgtgagagctttagagcacc 25343312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 265 - 339
Target Start/End: Complemental strand, 30352667 - 30352591
Alignment:
Q  265 gtaaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg 339  Q
    |||| ||||||||||||||||||||  || | ||||| |||| |||||||| |||||| | ||||||||||||||||    
T  30352667 gtaaagctgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccg 30352591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 334
Target Start/End: Complemental strand, 30581581 - 30581481
Alignment:
Q  237 tggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    |||||||| |||||||| |||||| |  |||||||| || |||||||||||| ||||| | ||||| ||||||||||||| | |||||  ||||||||||    
T  30581581 tggaaacaacctcttgtgtaaaaaaacagggtaagggtgtgtacaatacaccaaaatggtgggaccccttcccggaccctgcatatgtaggagctttagt 30581482  T
Q  334 g 334  Q
    |    
T  30581481 g 30581481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 332
Target Start/End: Complemental strand, 39029175 - 39029078
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacac-caaatgataggacctcttcccggaccctacgtatgtgagagctttag 332  Q
    ||||||||||||||||| ||||||  |||||||||||| |||||||||||  ||||| | ||||| ||| ||||||||| | |||| | |||||||||    
T  39029175 tggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacgaaaatggtgggaccactttccggaccctgcatatgcgggagctttag 39029078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 251 - 291
Target Start/End: Complemental strand, 12711548 - 12711508
Alignment:
Q  251 tgtataaaaatagggtaaggctgcgtacaatacaccaaatg 291  Q
    |||| |||||||||||||| |||||||||||||||||||||    
T  12711548 tgtaaaaaaatagggtaagactgcgtacaatacaccaaatg 12711508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 239 - 334
Target Start/End: Complemental strand, 32629380 - 32629285
Alignment:
Q  239 gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    |||||||||||||||| ||||| |||||||||| || ||| |||||||||| ||   ||||| ||||||||||| | |||||||| ||| |||||||    
T  32629380 gaaacagcctcttgtaaaaaaacagggtaaggccgcctac-atacaccaaattggcgggaccccttcccggaccttgcgtatgtgggagttttagtg 32629285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 237 - 336
Target Start/End: Original strand, 37494872 - 37494972
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||| |||||||| ||||||  ||||||||| ||| ||||||| |||||||| | ||||| ||| | ||||||| ||||||   ||||||||||||    
T  37494872 tggaaacaacctcttgtgtaaaaaacagggtaaggttgcatacaatataccaaatggtgggacccctttcgggaccctgcgtatgcaggagctttagtgc 37494971  T
Q  336 a 336  Q
    |    
T  37494972 a 37494972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 279 - 351
Target Start/End: Original strand, 38786673 - 38786745
Alignment:
Q  279 aatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    ||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||||||| ||||| ||||    
T  38786673 aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt 38786745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 39077948 - 39077888
Alignment:
Q  177 agttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||| ||||||||| | ||| ||||||||| ||||||||||||| |||||||||||    
T  39077948 agttgttgtcatgtgattgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 39077888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 244 - 351
Target Start/End: Complemental strand, 13256508 - 13256398
Alignment:
Q  244 agcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    |||||||||| ||||||  ||||||||||||||||||||||||||  |||  | ||||| ||||||| ||||  | | || | |||||||||||||||||    
T  13256508 agcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgg 13256409  T
Q  341 attgccttttt 351  Q
     ||||| ||||    
T  13256408 gttgccctttt 13256398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 32478899 - 32478802
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||| ||||| || |||||| ||||||||||||     ||||||||||||| | ||||| ||||||||||||  |||||| | ||||||| |||||    
T  32478899 tggaaacaacctctagtgtaaaaacagggtaaggctg-----aatacaccaaatggtgggaccccttcccggacccagcgtatgcgggagcttt-gtgca 32478806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 295 - 346
Target Start/End: Complemental strand, 38755963 - 38755912
Alignment:
Q  295 ggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc 346  Q
    ||||| ||||||||||||| |||||| | ||||||||||||||||| |||||    
T  38755963 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 38755912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 20224939 - 20225025
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| | |||||| |||||||||||||  |||||||||||    
T  20224939 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaa 20225025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 237 - 337
Target Start/End: Original strand, 21489108 - 21489210
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    ||||||||||||||||  ||||||  || ||||| ||||||||||| |||| ||||| | ||||| ||||||| ||||| |||||| | ||||||| |||    
T  21489108 tggaaacagcctcttgcgtaaaaaacagagtaagactgcgtacaatgcaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttcgtg 21489207  T
Q  335 cac 337  Q
    |||    
T  21489208 cac 21489210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 237 - 330
Target Start/End: Original strand, 25463143 - 25463237
Alignment:
Q  237 tggaaacagcctcttgtataaaaata-gggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttt 330  Q
    |||||||| |||||||| ||||||   ||| |||| ||||||||| |||||||||| | ||||| ||||||||||||| | |||| | |||||||    
T  25463143 tggaaacaacctcttgtgtaaaaaactgggaaaggttgcgtacaacacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt 25463237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 30639335 - 30639421
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | ||||||||||||  ||||| || | ||| || |||||| ||||||||||||| |||||||||||    
T  30639335 aggggtaaccttggcgcaactggtaaagttgttgtcttgtgactgaaaggtcactggttcaagtcctggaaacagactcttgtgtaa 30639421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 276 - 351
Target Start/End: Complemental strand, 33836563 - 33836486
Alignment:
Q  276 tacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    |||||||||||||  ||| | ||||| ||||||||||||| |||||| | ||||||||||||| ||| ||||| ||||    
T  33836563 tacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccctttt 33836486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 301 - 351
Target Start/End: Original strand, 35532078 - 35532128
Alignment:
Q  301 cttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    ||||||||||||| |||||| | ||||||||||||||||| ||||| ||||    
T  35532078 cttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt 35532128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 296 - 346
Target Start/End: Complemental strand, 40553991 - 40553941
Alignment:
Q  296 gacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc 346  Q
    |||| ||||||||||||| |||||| | ||||||||||||||||| |||||    
T  40553991 gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 40553941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 47528708 - 47528622
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| |  |||| | |||||||||||| |||||| || | ||| || |||||| ||||||||||||| |||||||||||    
T  47528708 aggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaa 47528622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 255 - 340
Target Start/End: Original strand, 15053973 - 15054058
Alignment:
Q  255 taaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    |||||||||||||||| || |||||| ||| ||||||||   |  ||||| |||||| |||||||| | || ||||||||||||||    
T  15053973 taaaaatagggtaaggttgtgtacaaaacatcaaatgatgaaatttcttcacggaccttacgtatgcgggaactttagtgcaccgg 15054058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 286 - 346
Target Start/End: Original strand, 11394923 - 11394983
Alignment:
Q  286 caaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc 346  Q
    |||||| | ||||| ||| ||||||||| |||||| | ||||||||||||||||| |||||    
T  11394923 caaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 11394983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 286 - 346
Target Start/End: Original strand, 11404650 - 11404710
Alignment:
Q  286 caaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc 346  Q
    |||||| | ||||| ||| ||||||||| |||||| | ||||||||||||||||| |||||    
T  11404650 caaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 11404710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 239 - 300
Target Start/End: Original strand, 14590860 - 14590923
Alignment:
Q  239 gaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacaccaaatgataggacct 300  Q
    ||||||||||||||| |||||| |  |||||||||||| ||||||||| |||||| | ||||||    
T  14590860 gaaacagcctcttgtctaaaaaaacagggtaaggctgcatacaatacatcaaatggtgggacct 14590923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 153 - 236
Target Start/End: Original strand, 14983791 - 14983875
Alignment:
Q  153 gggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||| ||| ||| | |||||||||||| || |||||||| ||| |||| ||| |||| | ||||||| |||||||||||    
T  14983791 gggtaaccttggcagaactggtaaagttgttgtcatatgattggaaggtcacggattcaagtctttgaaacagcctcttgtgtaa 14983875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 295 - 351
Target Start/End: Original strand, 32484313 - 32484369
Alignment:
Q  295 ggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    ||||| ||||||||||||| | |||| | ||||||||||||||||| ||||| ||||    
T  32484313 ggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt 32484369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 236 - 287
Target Start/End: Original strand, 51420594 - 51420646
Alignment:
Q  236 atggaaacagcctcttgtata-aaaatagggtaaggctgcgtacaatacacca 287  Q
    ||||||||| |||||||| || |||| |||||||||||| |||||||||||||    
T  51420594 atggaaacaacctcttgtgtagaaaacagggtaaggctgggtacaatacacca 51420646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 68; Significance: 4e-30; HSPs: 66)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 237 - 352
Target Start/End: Original strand, 9671202 - 9671316
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | |||||||||||||    
T  9671202 tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 9671300  T
Q  337 ccggattgccttttta 352  Q
    |||| ||||| |||||    
T  9671301 ccgggttgccctttta 9671316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 237 - 354
Target Start/End: Complemental strand, 8455430 - 8455312
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||||| ||||| | |||||||||||||||||||||||||||||| | ||||| ||||||||||||| ||||||   ||||||||||||    
T  8455430 tggaaacagcctcttgtgtaaaacacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgccggagctttagtgc 8455331  T
Q  336 accggattgcctttttata 354  Q
    ||||| ||||| |||||||    
T  8455330 accgggttgcccttttata 8455312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 10546183 - 10546299
Alignment:
Q  237 tggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    |||||||| ||||||||||||||| |  ||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | |||||||||||    
T  10546183 tggaaacatcctcttgtataaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg 10546282  T
Q  335 caccggattgccttttt 351  Q
    |||||| ||||| ||||    
T  10546283 caccgggttgccctttt 10546299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 14444750 - 14444864
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||| |||||||||||| |||| |||||||||||| | ||||| ||||||||||||| |||||| | |||||||||||||    
T  14444750 tggaaacagcctcttgtgtaaaaacagggtaaggctgtgtacgatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 14444849  T
Q  337 ccggattgccttttt 351  Q
    || | ||||| ||||    
T  14444850 ccaggttgccctttt 14444864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 36871514 - 36871627
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| | |||| |||||||||||||||||||||||||||||| | ||||| ||||||||| ||| |||||| | |||||||||||||    
T  36871514 tggaaacagcctcttgtgtgaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgga-cctgcgtatgcgggagctttagtgca 36871612  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||| ||||    
T  36871613 ccgggttgccctttt 36871627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 237 - 356
Target Start/End: Original strand, 11514457 - 11514576
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||||| ||||||  |  ||||||||||||||||||||||||||| | ||||| |||||| |||||| |||||| | ||||||||||||    
T  11514457 tggaaacagcctcttgtgtaaaaaacaaagtaaggctgcgtacaatacaccaaatggtgggacc-cttcccagaccctgcgtatgcgggagctttagtgc 11514555  T
Q  336 accggattgcctttttatatg 356  Q
    ||||||||||| |||||||||    
T  11514556 accggattgcccttttatatg 11514576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 12024032 - 12023929
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| | ||||||||||| ||||| ||  ||||||| ||||    
T  12024032 tggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccctcccggaccctgcgtatttggaagctttaatgca 12023933  T
Q  337 ccgg 340  Q
    ||||    
T  12023932 ccgg 12023929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 236 - 351
Target Start/End: Complemental strand, 25249852 - 25249737
Alignment:
Q  236 atggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||||| ||||||| || ||| |||||||||||||||||||||||||||||| | ||| | ||||||| ||||| |||||| | ||||||||||||    
T  25249852 atggaaacagtctcttgtgtacaaacagggtaaggctgcgtacaatacaccaaatggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgc 25249753  T
Q  336 accggattgccttttt 351  Q
    ||||| ||||| ||||    
T  25249752 accgggttgccctttt 25249737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 344
Target Start/End: Original strand, 30826058 - 30826164
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||||||||||||| |||||||||||||||||||| | ||| | |||||| |||||||| |||| | |||||||||||||    
T  30826058 tggaaacagcctcttgtgtaaaaatagggtaaggttgcgtacaatacaccaaatggt-ggaacccttcccagaccctacatatgcgggagctttagtgca 30826156  T
Q  337 ccggattg 344  Q
    || |||||    
T  30826157 ccagattg 30826164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 24200739 - 24200622
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| ||||||  ||||||||||||||||||||||||||||  || | ||| | |||||||||||||  ||||||||||||||||||    
T  24200739 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaacccttcccggaccctgagtatgtgagagctttagt 24200640  T
Q  334 gcaccggattgccttttt 351  Q
    ||||||| ||||| ||||    
T  24200639 gcaccgggttgccctttt 24200622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 24860100 - 24859987
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||| ||||| || |||||| | |||| ||||||||||||||||||||||| ||| ||| |||| |||||||| |||||| | |||||||||||||    
T  24860100 tggaaacaacctctggtgtaaaaacatggta-ggctgcgtacaatacaccaaatggtagaaccccttctcggaccctgcgtatgcgggagctttagtgca 24860002  T
Q  337 ccggattgccttttt 351  Q
    |||||||||||||||    
T  24860001 ccggattgccttttt 24859987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 14530339 - 14530451
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||||||||||  ||||||||||| |||||||||||||||  ||| | ||||| ||||||||||||| |||||| | ||||||||||    
T  14530339 tggaaacagcctcttgtataaaaaacagggtaaggctacgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagt 14530438  T
Q  334 gcaccggattgcc 346  Q
    ||||||| |||||    
T  14530439 gcaccgggttgcc 14530451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 23397787 - 23397895
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| ||||| |||||||||||| |||||||||||||||||| | ||||| |||| |||||||||| |||| | ||||| |||||||    
T  23397787 tggaaacagcctcttgtgtaaaa-tagggtaaggctacgtacaatacaccaaatggtgggaccccttctcggaccctacatatgcgggagctctagtgca 23397885  T
Q  337 ccggattgcc 346  Q
    |||| |||||    
T  23397886 ccgggttgcc 23397895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 40762348 - 40762238
Alignment:
Q  237 tggaaacagcctcttgtataaaaata-gggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||||| ||||||   |||||||||| |||||||||||||||||| | |||||  |||| ||||||| |||||||| ||||||||||||    
T  40762348 tggaaacagcctcttgtgtaaaaaactgggtaaggctacgtacaatacaccaaatggtgggaccctttcctggaccctgcgtatgtgggagctttagtgc 40762249  T
Q  336 accggattgcc 346  Q
    ||||| |||||    
T  40762248 accgggttgcc 40762238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 10543719 - 10543831
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||| ||||||||| ||||||  ||||||||||||||||||||||||||||  || | ||||| ||||||||||||| |||||| | ||||||||||    
T  10543719 tggaaacggcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagt 10543818  T
Q  334 gcaccggattgcc 346  Q
    ||||||| |||||    
T  10543819 gcaccgggttgcc 10543831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 251 - 336
Target Start/End: Original strand, 17896296 - 17896381
Alignment:
Q  251 tgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||| ||||||||||||||||||||||||||| |||||||| | ||||| |||| |||||||| |||||||| |||||||||||||    
T  17896296 tgtaaaaaaatagggtaaggctgcgtacaatataccaaatggtgggaccccttctcggaccctgcgtatgtgggagctttagtgca 17896381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 237 - 353
Target Start/End: Complemental strand, 21779373 - 21779258
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||| |||||||||||| |||||  ||||||||| |||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| |||||||    
T  21779373 tggagacagcctcttgtgtaaaac-agggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 21779275  T
Q  337 ccggattgcctttttat 353  Q
    |||| ||||| ||||||    
T  21779274 ccgggttgcccttttat 21779258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 17668023 - 17668138
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||| | |||||||| ||||||| |||||||||||||||||||||||||||||| | | ||| |||| || ||||| ||||| || ||||||||||||    
T  17668023 tggaaagaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacaccaaatggtggaaccccttctcgaaccctgcgtatatgggagctttagtgc 17668122  T
Q  336 accggattgccttttt 351  Q
    ||||| ||||| ||||    
T  17668123 accgggttgccctttt 17668138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 251 - 352
Target Start/End: Complemental strand, 26684719 - 26684617
Alignment:
Q  251 tgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattg-ccttt 349  Q
    |||| ||||||| ||||||||||||||||||| || ||||| | ||||||||||||| ||||| |||||| | |||||||| |||||||||||| |||||    
T  26684719 tgtaaaaaaatatggtaaggctgcgtacaatatactaaatggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccggattgtccttt 26684620  T
Q  350 tta 352  Q
    |||    
T  26684619 tta 26684617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 239 - 351
Target Start/End: Original strand, 17623587 - 17623700
Alignment:
Q  239 gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac 337  Q
    |||||| |||||||| ||||||| |||||||||||||||||||||||||||||| | | ||| ||||||| | ||| ||||||||  |||||||||||||    
T  17623587 gaaacaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcac 17623686  T
Q  338 cggattgccttttt 351  Q
     || ||||| ||||    
T  17623687 tgggttgccctttt 17623700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 251 - 346
Target Start/End: Complemental strand, 25079816 - 25079721
Alignment:
Q  251 tgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc 346  Q
    |||| ||||| | ||||||| ||||||||||||||| |||| | ||||| ||||||||||||| ||||||  |||||||||||||||||| |||||    
T  25079816 tgtaaaaaaacaaggtaaggatgcgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgcc 25079721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 239 - 340
Target Start/End: Complemental strand, 4516463 - 4516361
Alignment:
Q  239 gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac 337  Q
    ||||||||||||||| ||||||  |||| || ||||||||||||||||||| || | ||||| ||||||||||||| ||||||||  |||||||||| ||    
T  4516463 gaaacagcctcttgtgtaaaaaacagggcaacgctgcgtacaatacaccaattggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtac 4516364  T
Q  338 cgg 340  Q
    |||    
T  4516363 cgg 4516361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 313
Target Start/End: Original strand, 22371078 - 22371152
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct 313  Q
    ||||||||||||| ||||  |||| |||||||||||||||||||||||||||||| | ||||| |||||||||||||    
T  22371078 tggaaacagcctcgtgta--aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct 22371152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 344
Target Start/End: Original strand, 25641523 - 25641630
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||||| | |||| | |||| ||||||| | |||||||||||||||||||  | ||||| ||||||| | ||| |||||| ||||||||||||| |    
T  25641523 tggaaacagcattttgtgtgaaaacagggtaaagttgcgtacaatacaccaaattgtgggaccccttcccgaatcctgcgtatgcgagagctttagtgaa 25641622  T
Q  337 ccggattg 344  Q
    ||||||||    
T  25641623 ccggattg 25641630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 236 - 291
Target Start/End: Complemental strand, 30864531 - 30864476
Alignment:
Q  236 atggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatg 291  Q
    |||||||||||||||||| |||||||||||||||| ||||||||||| ||||||||    
T  30864531 atggaaacagcctcttgtgtaaaaatagggtaagggtgcgtacaatataccaaatg 30864476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 236 - 346
Target Start/End: Complemental strand, 40416986 - 40416875
Alignment:
Q  236 atggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    ||||||||| |||||||||||||||  |||| ||||||| |||||||||||||| |||| |||||  ||   ||||||| | |||| |||||||||||||    
T  40416986 atggaaacaacctcttgtataaaaaacagggaaaggctgtgtacaatacaccaattgatgggacccttttttggaccctgcatatgcgagagctttagtg 40416887  T
Q  335 caccggattgcc 346  Q
    |||||| |||||    
T  40416886 caccgggttgcc 40416875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 256 - 346
Target Start/End: Original strand, 25632550 - 25632640
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc 346  Q
    ||||| ||| |||||||||||||||||||||||||| | |||   ||||||| ||| |||||||| | ||||||||||||||||| |||||    
T  25632550 aaaaacaggataaggctgcgtacaatacaccaaatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgcc 25632640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 241 - 351
Target Start/End: Original strand, 27573646 - 27573756
Alignment:
Q  241 aacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    ||||||||||||| || ||| | |||||||||||||||||||||||||||| | | |||  |||||  |||||  ||||||| ||||||||||||| |||    
T  27573646 aacagcctcttgtgtataaacatggtaaggctgcgtacaatacaccaaatggtggaaccatttcccaaaccctgtgtatgtgggagctttagtgcatcgg 27573745  T
Q  341 attgccttttt 351  Q
     ||||| ||||    
T  27573746 gttgccctttt 27573756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 148 - 236
Target Start/End: Original strand, 10543650 - 10543739
Alignment:
Q  148 ataaggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||||||||| || |||| |||||||||||||| |||||| || | ||| |||||||| |||||||||||| | |||||||||||    
T  10543650 ataaggggtaaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacggcctcttgtgtaa 10543739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 239 - 339
Target Start/End: Complemental strand, 21377185 - 21377085
Alignment:
Q  239 gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac 337  Q
    |||||| |||||||| ||||||  |||||||||||| ||||||| ||||||||| | ||||| ||||||| ||||| |||||||| ||||||| ||||||    
T  21377185 gaaacatcctcttgtgtaaaaaacagggtaaggctgggtacaatgcaccaaatggtgggaccccttcccgaaccctgcgtatgtgggagcttt-gtgcac 21377087  T
Q  338 cg 339  Q
    ||    
T  21377086 cg 21377085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 249 - 349
Target Start/End: Complemental strand, 39499331 - 39499231
Alignment:
Q  249 cttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcctt 348  Q
    |||||||||||||||||||| ||||||||||||||| |||||| | ||| | |||  || | ||| |||||| | ||||||||||||||| ||||| |||    
T  39499331 cttgtataaaaatagggtaaagctgcgtacaatacatcaaatggtgggatcccttttcgaatcctgcgtatgcgggagctttagtgcaccagattgtctt 39499232  T
Q  349 t 349  Q
    |    
T  39499231 t 39499231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 237 - 343
Target Start/End: Complemental strand, 19977828 - 19977721
Alignment:
Q  237 tggaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||| | |||||| |||| ||||| |||||||||||||||||||| | ||| | ||||||| ||| |  ||||| | ||||||||||||    
T  19977828 tggaaacagcctcttttgtaaaaaataggataaggttgcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttagtgc 19977729  T
Q  336 accggatt 343  Q
    ||| ||||    
T  19977728 accagatt 19977721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 12024098 - 12024012
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| |||||||||||    
T  12024098 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 12024012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 239 - 352
Target Start/End: Original strand, 5841051 - 5841167
Alignment:
Q  239 gaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||||| |||| ||||| ||||||||||| ||||||||||||| ||  |||| | ||||| ||||||||||||  | |||| | ||||||||||||    
T  5841051 gaaacagccttttgtgtaaaaaatagggtaaggatgcgtacaatacatcaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgc 5841150  T
Q  336 accggattgccttttta 352  Q
    ||||  ||||| |||||    
T  5841151 accgagttgccctttta 5841167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 152 - 236
Target Start/End: Original strand, 11514392 - 11514477
Alignment:
Q  152 ggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| | |||||||||||| |||||||||||    
T  11514392 ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaactcctggaaacagcctcttgtgtaa 11514477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 264 - 337
Target Start/End: Original strand, 24890460 - 24890533
Alignment:
Q  264 ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac 337  Q
    ||||||||||| ||||||||||||| || | ||||| ||||||||||||| ||||||   ||||||||||||||    
T  24890460 ggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac 24890533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 238 - 330
Target Start/End: Complemental strand, 32781401 - 32781308
Alignment:
Q  238 ggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttt 330  Q
    ||||||| |||||||| ||||||  |||||||| ||||||||||||||||||||| | ||||| |||||| ||||||  ||||| | |||||||    
T  32781401 ggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccagaccctgtgtatgcgggagcttt 32781308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 256 - 340
Target Start/End: Original strand, 44643564 - 44643648
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    ||||| || |||||||||||||||||  |||||||| | ||||| |||||| |||||| |||||| | |||| ||||||||||||    
T  44643564 aaaaacagagtaaggctgcgtacaatgtaccaaatggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgg 44643648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 239 - 334
Target Start/End: Complemental strand, 99375 - 99281
Alignment:
Q  239 gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    |||||||||||||||| ||||| | || ||||||||||||||||||||||||| | | ||| |||| | ||||||  ||||| | |||||||||||    
T  99375 gaaacagcctcttgta-aaaaacatggcaaggctgcgtacaatacaccaaatggtggaaccccttctcagaccctgtgtatgcgggagctttagtg 99281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 17380350 - 17380248
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||| |||||||| || ||| ||||||||| || || |||||||||||||||| | ||| ||||| ||||||| || ||| | ||||||| |||||    
T  17380350 tggaaacaacctcttgtgtataaacagggtaaggttgtgtgcaatacaccaaatgatggaaccccttcctggaccctgcggatgcgggagcttt-gtgca 17380252  T
Q  337 ccgg 340  Q
    ||||    
T  17380251 ccgg 17380248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 237 - 316
Target Start/End: Original strand, 5450306 - 5450387
Alignment:
Q  237 tggaaacagcctcttgtataaaaatag--ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacg 316  Q
    |||||||| |||||||| |||||| |   |||||||||||||||||||||||||| | | ||||| ||||| ||||||||||    
T  5450306 tggaaacaacctcttgtgtaaaaaaacatggtaaggctgcgtacaatacaccaaagggtgggaccccttcctggaccctacg 5450387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 7214489 - 7214575
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||| || ||||||| | |||||||||||| |||||| || | ||| | |||||| |||| |||||||||||||||||||||    
T  7214489 aggggtaactttggcacaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaa 7214575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 7214555 - 7214672
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacac--caaatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||| ||||||| ||||| | ||||||||||||||||||||||||   ||||| |  || | |||| ||||| || |||||| ||||| ||||||    
T  7214555 tggaaacagtctcttgtgtaaaatacagggtaaggctgcgtacaatacacaaaaaatggtgagatcccttctcggacactgcgtatgcgagagttttagt 7214654  T
Q  334 gcaccggattgccttttt 351  Q
    ||||| | ||||||||||    
T  7214655 gcaccaggttgccttttt 7214672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 232
Target Start/End: Original strand, 14530273 - 14530355
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgt 232  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| |||||||    
T  14530273 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt 14530355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 295 - 345
Target Start/End: Original strand, 23488563 - 23488613
Alignment:
Q  295 ggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgc 345  Q
    ||||| ||||||||||||| |||||| ||||||||||||||||||| ||||    
T  23488563 ggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgc 23488613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 256 - 338
Target Start/End: Complemental strand, 31821437 - 31821355
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||||||||||||| || ||||||||||||||||||| ||||| ||| ||| | |||  ||||| | |||||||| ||||||    
T  31821437 aaaaatagggtaaggttgtgtacaatacaccaaatgatgggacccctttccgaaacctgtgtatgcgggagctttaatgcacc 31821355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 237 - 352
Target Start/End: Complemental strand, 39914420 - 39914304
Alignment:
Q  237 tggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    |||||||| |||||||| |||||| |  |||||||| || |||||||||||| |||| | ||||| ||| || |||||| |||||| | |||||||||||    
T  39914420 tggaaacaacctcttgtgtaaaaaaacagggtaaggatgtgtacaatacaccgaatggtgggacccctt-cctgaccctgcgtatgcgggagctttagtg 39914322  T
Q  335 caccggattgccttttta 352  Q
    || ||| ||||| |||||    
T  39914321 catcgggttgccctttta 39914304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 302 - 350
Target Start/End: Complemental strand, 124962 - 124914
Alignment:
Q  302 ttcccggaccctacgtatgtgagagctttagtgcaccggattgcctttt 350  Q
    |||||||||||| |||||| | ||||||||||||||||| |||||||||    
T  124962 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcctttt 124914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 239 - 351
Target Start/End: Original strand, 19615015 - 19615129
Alignment:
Q  239 gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgata--ggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||| |||||||||||||||  |||||||| |||||||||||| ||| ||| |||  ||||| ||||||| ||||| ||||||   ||||||||||||    
T  19615015 gaaacatcctcttgtataaaaaacagggtaagactgcgtacaatatacc-aataatagtggaccccttcccgaaccctgcgtatgcaggagctttagtgc 19615113  T
Q  336 accggattgccttttt 351  Q
    |||  ||| |||||||    
T  19615114 accatattaccttttt 19615129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 240 - 338
Target Start/End: Complemental strand, 44449495 - 44449395
Alignment:
Q  240 aaacagcctcttgtat-aaaaatagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac 337  Q
    ||||| ||||||| || ||||| ||| ||||||||||||||||||||| ||||  | ||||| ||||||||||||| ||| |||| ||| |||| |||||    
T  44449495 aaacaacctcttgaatgaaaaacaggataaggctgcgtacaatacaccaaaatagtgggaccccttcccggaccctgcgtttgtgggagttttaatgcac 44449396  T
Q  338 c 338  Q
    |    
T  44449395 c 44449395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 295 - 338
Target Start/End: Original strand, 8575975 - 8576018
Alignment:
Q  295 ggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||| ||||||||||||| |||||||| |||||||||||||||    
T  8575975 ggaccccttcccggaccctgcgtatgtgggagctttagtgcacc 8576018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 338
Target Start/End: Original strand, 14544084 - 14544189
Alignment:
Q  237 tggaaacagcctcttgtata--aaaatagggtaaggctgcgtacaata--caccaaatgataggacctcttcccggaccctacgtatgtgagagctttag 332  Q
    ||||||||||||||||| ||  |||| |||||||| |||||| |||||  ||  ||||| | ||||| ||||| ||||||| |||||| | |||||||||    
T  14544084 tggaaacagcctcttgtgtagaaaaacagggtaagactgcgtgcaataaccaaaaaatggtcggaccccttccgggaccctgcgtatgcgggagctttag 14544183  T
Q  333 tgcacc 338  Q
    ||||||    
T  14544184 tgcacc 14544189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 302 - 353
Target Start/End: Original strand, 22371199 - 22371250
Alignment:
Q  302 ttcccggaccctacgtatgtgagagctttagtgcaccggattgcctttttat 353  Q
    |||||||||||| |||||| | ||||||||||||||||| ||||| ||||||    
T  22371199 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttat 22371250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 153 - 235
Target Start/End: Complemental strand, 25249915 - 25249832
Alignment:
Q  153 gggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgta 235  Q
    |||||||||| || |||  | |||||||||||| |||||| || | ||| ||||||||| ||| ||||||||||||||||||||    
T  25249915 gggtaaccttggcgcaattggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatggaaacagtctcttgtgta 25249832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 5840983 - 5841069
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| |  |||  |||||||||||||| |||||| |||| ||| |||||||| |||||| ||||||| || ||||||||    
T  5840983 aggggtaaccttggtgcaaatgataaagttgttgtcatgtgactggaaggtcacgggttcaagtcctagaaacagccttttgtgtaa 5841069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 239 - 341
Target Start/End: Original strand, 17471571 - 17471676
Alignment:
Q  239 gaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||| |||||| |  || |||| |||||||||||| ||| |||||||  |||| |||||| |||||| | |||| | ||| ||||||||    
T  17471571 gaaacagcctcttgtgtaaaaaaacaggataagactgcgtacaatataccaaaatgatgagaccccttccctgaccctgcctatgcgggagttttagtgc 17471670  T
Q  336 accgga 341  Q
    ||||||    
T  17471671 accgga 17471676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 17705450 - 17705536
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| |  |||| | |||||||||||| |||||| | || ||| |||||||| |||||||||||| | |||||||||||    
T  17705450 aggggtaaccttggtgcaactggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaaccgcctcttgtgtaa 17705536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 21779439 - 21779353
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | | |||||||||| |||||| || | ||| |||||||| ||||||||| |||| |||||||||||    
T  21779439 aggggtaaccttggcgcaactggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggagacagcctcttgtgtaa 21779353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 224
Target Start/End: Original strand, 22371012 - 22371086
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacag 224  Q
    |||||||||||| || |||| | |||||||||||| |||||| |||  ||| |||||||| ||||||||||||||    
T  22371012 aggggtaaccttggcccaactggtaaagttgttgtcatgtgactgggaggtcacgggttcaagtcctggaaacag 22371086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 23397721 - 23397807
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| |  |||| | |||||||||||| |||||| || | ||| | ||||||| ||||||||||||| |||||||||||    
T  23397721 aggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaa 23397807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 23145809 - 23145736
Alignment:
Q  240 aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccc 312  Q
    |||||| ||||||| ||||||  || |||||||||||||||||||||||| || | |||||  |||||||||||    
T  23145809 aaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaattggtgggaccctttcccggaccc 23145736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 23557599 - 23557526
Alignment:
Q  240 aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccc 312  Q
    |||||| ||||||| ||||||  || |||||||||||||||||||||||| || | |||||  |||||||||||    
T  23557599 aaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaattggtgggaccctttcccggaccc 23557526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 151 - 211
Target Start/End: Complemental strand, 8455496 - 8455436
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca 211  Q
    |||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||||    
T  8455496 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttca 8455436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 238 - 289
Target Start/End: Complemental strand, 15296520 - 15296468
Alignment:
Q  238 ggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaa 289  Q
    ||||||||||| |||| ||||| | ||||||||||||||||||||| ||||||    
T  15296520 ggaaacagcctgttgtgtaaaatacagggtaaggctgcgtacaatataccaaa 15296468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 165 - 236
Target Start/End: Original strand, 17667971 - 17668043
Alignment:
Q  165 cacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||| | |||||||||||| |||||| |||| ||| |||||||| ||||||||||| |  |||||||||||    
T  17667971 cacaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaagaacctcttgtgtaa 17668043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 151 - 211
Target Start/End: Complemental strand, 25079898 - 25079838
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca 211  Q
    |||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||||    
T  25079898 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttca 25079838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 66; Significance: 6e-29; HSPs: 64)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 45071286 - 45071395
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||| | |||||| | |||||| ||||||    
T  45071286 tggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgca 45071385  T
Q  337 ccggattgcc 346  Q
    |||| |||||    
T  45071386 ccgggttgcc 45071395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 239 - 346
Target Start/End: Original strand, 13160725 - 13160832
Alignment:
Q  239 gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | |||||| ||||| ||    
T  13160725 gaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgcc 13160824  T
Q  339 ggattgcc 346  Q
    || |||||    
T  13160825 gggttgcc 13160832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 18164873 - 18164759
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||| ||||||||| |||||||||||||||||| |||  ||||  |||||||||||| |||||| | |||||||||||||    
T  18164873 tggaaacagcctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaaggatgtgaccatttcccggaccctgcgtatgcgggagctttagtgca 18164774  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||| ||||    
T  18164773 ccgggttgccatttt 18164759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 237 - 353
Target Start/End: Original strand, 36720817 - 36720934
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||||| ||||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| |  |||||||||||    
T  36720817 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgc 36720916  T
Q  336 accggattgcctttttat 353  Q
    ||| | ||||| ||||||    
T  36720917 acccggttgcccttttat 36720934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 28817740 - 28817625
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||||| ||||||  ||||||||||||||||||||||||| |||| | ||||| ||||||||||||| |||||| | ||||||||||||    
T  28817740 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacccaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgc 28817641  T
Q  336 accggattgccttttt 351  Q
    | ||| ||||| ||||    
T  28817640 atcgggttgccctttt 28817625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 240 - 354
Target Start/End: Original strand, 31457197 - 31457311
Alignment:
Q  240 aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg 339  Q
    ||||| |||||||| ||||||||||  |||||||||||||||||| |||||| ||||||| ||||||  ||||| |||||| | ||||| ||||||||||    
T  31457197 aaacaacctcttgtgtaaaaataggaaaaggctgcgtacaatacatcaaatggtaggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccg 31457296  T
Q  340 gattgcctttttata 354  Q
    ||||||| |||||||    
T  31457297 gattgcccttttata 31457311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 237 - 353
Target Start/End: Original strand, 44530170 - 44530287
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||| |||||||| ||||||  |||||||||||||||||||||||||||||| | ||||| ||||| ||||||| |||||| | ||||||||||||    
T  44530170 tggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgc 44530269  T
Q  336 accggattgcctttttat 353  Q
    ||||| ||| | ||||||    
T  44530270 accgggttgaccttttat 44530287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 256 - 351
Target Start/End: Original strand, 389686 - 389781
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    ||||| ||||||||| |||||||||||||||||||||| ||| | ||| || |||||| |||||| |||||||||||||||||||||| |||||||    
T  389686 aaaaacagggtaaggttgcgtacaatacaccaaatgatgggatccctttcctgaccctgcgtatgcgagagctttagtgcaccggattaccttttt 389781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 12670362 - 12670260
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| |||||||    
T  12670362 tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 12670264  T
Q  337 ccgg 340  Q
    ||||    
T  12670263 ccgg 12670260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 35261700 - 35261815
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||| ||||||| ||||||  ||||||||| |||||||||||||||||||| | ||||| ||||| ||||||| |||||| | ||||||||||||    
T  35261700 tggaaacagtctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgc 35261799  T
Q  336 accggattgccttttt 351  Q
    ||||| ||||| ||||    
T  35261800 accgggttgccctttt 35261815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 338
Target Start/End: Original strand, 29877115 - 29877217
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||||||| |||| ||||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | |||| |||||||    
T  29877115 tggaaacagccttttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcgttagtgc 29877214  T
Q  336 acc 338  Q
    |||    
T  29877215 acc 29877217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 355
Target Start/End: Complemental strand, 39461110 - 39460989
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| ||||||  || ||||||||||||||||||||||||  ||| |  |||| ||||||||||||| |||||| | ||||||||||    
T  39461110 tggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttagt 39461011  T
Q  334 gcaccggattgcctttttatat 355  Q
    ||||||| ||||| ||||||||    
T  39461010 gcaccgggttgcccttttatat 39460989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 237 - 345
Target Start/End: Complemental strand, 29521799 - 29521690
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||||| ||||||  |||||||||||||||||||||||||||||| | ||| | | |||| |||||| |||||| | ||||||||||||    
T  29521799 tggaaacagcctcttgtttaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaacccatcccagaccctgcgtatgcgggagctttagtgc 29521700  T
Q  336 accggattgc 345  Q
    ||||| ||||    
T  29521699 accgggttgc 29521690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 20284187 - 20284079
Alignment:
Q  237 tggaaacagcctcttgtataaaaata---gggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagcttta 331  Q
    |||||||||||||||||||||||| |   |||||||||||||||||||||||||  |||| | ||||| ||||||||||||| |||||| | ||| ||||    
T  20284187 tggaaacagcctcttgtataaaaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagtttta 20284088  T
Q  332 gtgcaccgg 340  Q
    |||||||||    
T  20284087 gtgcaccgg 20284079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 239 - 339
Target Start/End: Complemental strand, 24365172 - 24365071
Alignment:
Q  239 gaaacagcctcttgtataaaaat--agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||| ||||||   |||||||||||||| ||||||||||||||| | ||||| ||||||||||||| |||||||| ||||||| |||||    
T  24365172 gaaacagcctcttgtgtaaaaaatcagggtaaggctgcgaacaatacaccaaatggtgggaccccttcccggaccctgcgtatgtgggagcttt-gtgca 24365074  T
Q  337 ccg 339  Q
    |||    
T  24365073 ccg 24365071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 244 - 345
Target Start/End: Original strand, 5689659 - 5689761
Alignment:
Q  244 agcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggat 342  Q
    |||||||||| ||||||  |||||||||||||||||||||||||||||| | | ||| ||||||| ||| | |||||||| ||||||||||||||||| |    
T  5689659 agcctcttgtgtaaaaagcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaaccatgcgtatgtgggagctttagtgcaccggtt 5689758  T
Q  343 tgc 345  Q
    |||    
T  5689759 tgc 5689761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 237 - 352
Target Start/End: Original strand, 12625910 - 12626027
Alignment:
Q  237 tggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    |||||||| |||||||| |||||| |  ||||||| |||| |||||||||||||||| | ||||| | ||||||||||| |||||| | |||||||||||    
T  12625910 tggaaacaacctcttgtgtaaaaaaacagggtaagactgcatacaatacaccaaatggtgggaccccctcccggaccctgcgtatgcgggagctttagtg 12626009  T
Q  335 caccggattgccttttta 352  Q
    |||||| ||||| |||||    
T  12626010 caccgggttgccctttta 12626027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 30454209 - 30454096
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  ||| ||||||||||||| |||||||||||| | ||||| ||||||||||||| | |||| | ||||| |||||||    
T  30454209 tggaaacagcctcttgtgtaaaacaagg-taaggctgcgtacgatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 30454111  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||| ||||    
T  30454110 ccgggttgccctttt 30454096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 21070816 - 21070707
Alignment:
Q  237 tggaaacagcctcttgtataaaaata----gggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagcttt 330  Q
    |||||||||||||||||||||||| |    |||||||||||||||||||||||||  |||| | ||||| ||||||||||||| |||||| | ||| |||    
T  21070816 tggaaacagcctcttgtataaaaaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagtttt 21070717  T
Q  331 agtgcaccgg 340  Q
    ||||||||||    
T  21070716 agtgcaccgg 21070707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 2626540 - 2626653
Alignment:
Q  237 tggaaacagcctcttgtataaaaata----gggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttag 332  Q
    ||||||||||||||||| |||||| |    ||||||| ||||||||||||||||||||||| ||||| |||||| |||||| | |||| | |||||| ||    
T  2626540 tggaaacagcctcttgtgtaaaaaaaaacagggtaagactgcgtacaatacaccaaatgatgggaccccttcccagaccctgcatatgcgggagcttcag 2626639  T
Q  333 tgcaccggattgcc 346  Q
    |||||| |||||||    
T  2626640 tgcaccagattgcc 2626653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 320
Target Start/End: Complemental strand, 5135403 - 5135319
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatg 320  Q
    ||||||||||||||||| ||||||  |||||||||||| ||||||||||||||||| | ||||| ||||||||||||| ||||||    
T  5135403 tggaaacagcctcttgtgtaaaaaagagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatg 5135319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 256 - 351
Target Start/End: Complemental strand, 8897858 - 8897763
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    ||||||||||||||||| |||||||||||||||||| | ||||| ||||||||||||| | |||| | |||||||| |||||| | ||||| ||||    
T  8897858 aaaaatagggtaaggctacgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttactgcacccggttgccctttt 8897763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 251 - 351
Target Start/End: Original strand, 10857865 - 10857965
Alignment:
Q  251 tgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcctttt 350  Q
    |||| ||||| |||||||||||||| |||||||||||| || | ||||| ||||| ||||| | |||||| | ||||||||||||||||| ||||| |||    
T  10857865 tgtaaaaaaacagggtaaggctgcgcacaatacaccaattggtgggaccacttcctggaccttgcgtatgcgggagctttagtgcaccgggttgcccttt 10857964  T
Q  351 t 351  Q
    |    
T  10857965 t 10857965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 257 - 353
Target Start/End: Original strand, 19729382 - 19729478
Alignment:
Q  257 aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcctttttat 353  Q
    |||| |||||||||||| ||||||||||||||||| | ||||| ||||||||||||| | |||  | ||||| |||||||| |||||||| ||||||    
T  19729382 aaaacagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatacgggagctctagtgcactggattgcccttttat 19729478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 7136643 - 7136537
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    |||||||| |||||||| ||||||  ||||||||||||||||||||||||||  |||| | ||||| ||||||||||||  | |||| | ||||||||||    
T  7136643 tggaaacaacctcttgtgtaaaaaccagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagt 7136544  T
Q  334 gcaccgg 340  Q
    |||||||    
T  7136543 gcaccgg 7136537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 6760843 - 6760960
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| ||||||  ||||||||||| ||||||||||||||  |||| | ||||| |||| |||||||  | |||| | ||||||||||    
T  6760843 tggaaacagcctcttgtgtaaaaaacagggtaaggcttcgtacaatacaccaataatggtgggaccccttctcggaccccgcatatgcgggagctttagt 6760942  T
Q  334 gcaccggattgccttttt 351  Q
    ||||||| ||||| ||||    
T  6760943 gcaccgggttgccctttt 6760960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 20869944 - 20870061
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||| ||||||| ||||||  ||||||||||||||||||||||||||  |||| | ||||| ||||| ||||||  | |||| | ||||||||||    
T  20869944 tggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagctttagt 20870043  T
Q  334 gcaccggattgccttttt 351  Q
    ||||||| ||||| ||||    
T  20870044 gcaccgggttgccctttt 20870061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 35261634 - 35261720
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| || |||||||||||||||||||||||    
T  35261634 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagccctggaaacagtctcttgtgtaa 35261720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 8484052 - 8483948
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||| |||||||| ||||||  |||| |||||||||||||||||||||| || | ||||| | |||| |||||| |||||| | ||||||||| ||    
T  8484052 tggaaacaacctcttgtgtaaaaaacagggcaaggctgcgtacaatacaccaattggtgggaccccatcccagaccctgcgtatgcgggagctttagggc 8483953  T
Q  336 accgg 340  Q
    |||||    
T  8483952 accgg 8483948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 12670428 - 12670342
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| |||||||||||    
T  12670428 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 12670342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 17823597 - 17823707
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||||| ||||||  ||| |||| ||||||| ||||||||||||| | | ||| ||||||| ||||| | ||||   ||||||||||||    
T  17823597 tggaaacagcctcttgtgtaaaaaccaggataagactgcgtaaaatacaccaaatggtggaaccccttcccgaaccctgcatatgcaggagctttagtgc 17823696  T
Q  336 accggattgcc 346  Q
    ||||| |||||    
T  17823697 accgggttgcc 17823707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 25250543 - 25250660
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    |||||||||||| |||| ||||| |||||||| |||||||||||||||||||  |||| | ||||| ||||||| ||||  | |||| | ||| ||||||    
T  25250543 tggaaacagcctattgtgtaaaaaatagggtatggctgcgtacaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagatttagt 25250642  T
Q  334 gcaccggattgccttttt 351  Q
    ||||||| ||||| ||||    
T  25250643 gcaccgggttgccctttt 25250660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 232
Target Start/End: Complemental strand, 29521865 - 29521783
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgt 232  Q
    |||||||||||| || |||| ||||||||||||||  ||||| |||| ||| |||||||| |||||||||||||| |||||||    
T  29521865 aggggtaaccttggcgcaactgataaagttgttgtcgtgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgt 29521783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 30454275 - 30454189
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| |||||||||||    
T  30454275 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 30454189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 36720751 - 36720837
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| ||  ||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||| |||||||||||    
T  36720751 aggggtaaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 36720837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 259 - 351
Target Start/End: Original strand, 26457773 - 26457863
Alignment:
Q  259 aatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    |||||||||||||||||||||||||||||| || | ||||| ||  || |||| | |||||| | ||||||||||||||||| || |||||||    
T  26457773 aatagggtaaggctgcgtacaatacaccaattggtgggacccct--cctgaccttgcgtatgagggagctttagtgcaccgggtttccttttt 26457863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 352
Target Start/End: Original strand, 26954153 - 26954272
Alignment:
Q  237 tggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttag 332  Q
    ||||||||||||||||| |||||| |  |||||||||||||||||||||||||  |||| | ||||| |||||| ||||   | |||| | |||||||||    
T  26954153 tggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagacctcgcatatgcgggagctttag 26954252  T
Q  333 tgcaccggattgccttttta 352  Q
    ||||| || ||||| |||||    
T  26954253 tgcactgggttgccctttta 26954272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 256 - 340
Target Start/End: Complemental strand, 44742613 - 44742528
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    ||||| ||||||||||||||||||||||||| ||||| | ||||| ||||  |||||||||| ||| | |||| ||||||||||||    
T  44742613 aaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcttggaccctacggatgcgggagcattagtgcaccgg 44742528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 237 - 309
Target Start/End: Complemental strand, 23000332 - 23000260
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccgga 309  Q
    ||||||||||||||||| |||||| | ||||||| | | |||||||||||||||| | ||||| |||||||||    
T  23000332 tggaaacagcctcttgtgtaaaaacacggtaaggttccatacaatacaccaaatggtgggaccccttcccgga 23000260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 40604999 - 40604904
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttta 352  Q
    |||||| || ||||| |||||||||||||| ||||||| ||| | |||||   |||||||||||| | |||||||||||||||| |||||| |||||    
T  40604999 aaaaattggataaggttgcgtacaatacactaaatgat-ggatcccttccgaaaccctacgtatgcgggagctttagtgcaccgaattgccctttta 40604904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 44781620 - 44781517
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacacc--aaatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    |||||||| |||||||| ||||| | |||||||||||| ||||||||||||  ||||| | ||||| | |||| |||||| |||||| | ||||||||||    
T  44781620 tggaaacaacctcttgtgtaaaagacagggtaaggctgtgtacaatacaccaaaaatgttgggaccccgtcccagaccctgcgtatgcgggagctttagt 44781521  T
Q  334 gcac 337  Q
    ||||    
T  44781520 gcac 44781517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 276 - 351
Target Start/End: Original strand, 26102578 - 26102653
Alignment:
Q  276 tacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    |||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||||||| ||||| ||||    
T  26102578 tacaatacaccaaatggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgccctttt 26102653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 236
Target Start/End: Original strand, 26954110 - 26954173
Alignment:
Q  174 taaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| |||||||| || ||| |||||||| |||||||||||||| |||||||||||    
T  26954110 taaagttgttgtcatgtgattagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 26954173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 236
Target Start/End: Original strand, 28407394 - 28407457
Alignment:
Q  174 taaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| |||||| |||| ||| |||||||| |||||||||||||| |||||||||||    
T  28407394 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 28407457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 283 - 346
Target Start/End: Original strand, 28407471 - 28407534
Alignment:
Q  283 caccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc 346  Q
    ||||||||| | ||||| |||||||||||||||||||| | |||||||| |||||||| |||||    
T  28407471 caccaaatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgcc 28407534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 314
Target Start/End: Original strand, 35105944 - 35106023
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacacca-aatgataggacctcttcccggacccta 314  Q
    |||||||| |||||||| ||||| | || ||||||||||||||||||||||| |||| | ||||||||||| ||||||||    
T  35105944 tggaaacaacctcttgtgtaaaagagagtgtaaggctgcgtacaatacaccagaatggtgggacctcttcctggacccta 35106023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 7136709 - 7136623
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| |||| ||| | |||||| |||||||||||||  |||||||||||    
T  7136709 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaa 7136623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 20869676 - 20869590
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||| ||||||| || |||| | |||||||||||| |||||| || | ||| ||||||||| ||||||||||||| |||||||||||    
T  20869676 agggataaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 20869590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 40605085 - 40604999
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||| || || |||| | |||||||||||| ||||||||||||| ||| |||||| |||| |||||||| ||| ||||||||    
T  40605085 aggggtaactttggcgcaactggtaaagttgttgtcatgtgattggatgattatgggttcaagtcatggaaacaatcttttgtgtaa 40604999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 287 - 351
Target Start/End: Original strand, 18595910 - 18595974
Alignment:
Q  287 aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    ||||||||||||| |||||||||||||  ||||| | ||| ||||||||| ||| ||||||||||    
T  18595910 aaatgataggaccccttcccggaccctgtgtatgcgggagttttagtgcatcgggttgccttttt 18595974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 256 - 336
Target Start/End: Original strand, 36918165 - 36918245
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||| |||||||||||| ||||||||||||||||  |||||   ||||||  |||||| ||||| |||||||||| ||||    
T  36918165 aaaaacagggtaaggctgtgtacaatacaccaaatagtaggattccttcccaaaccctatgtatgcgagagctttaatgca 36918245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 256 - 340
Target Start/End: Original strand, 16225060 - 16225146
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    ||||| |||||||| |||||||||||||||||  |||| | ||| | ||||||||||||  | |||| | |||||||||||||||||    
T  16225060 aaaaacagggtaagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcaccgg 16225146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 288
Target Start/End: Complemental strand, 20869610 - 20869560
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaa 288  Q
    ||||||||||||||||| |||||  |||||||||||| ||||||||||||||    
T  20869610 tggaaacagcctcttgtgtaaaac-agggtaaggctgtgtacaatacaccaa 20869560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 154 - 236
Target Start/End: Original strand, 25250480 - 25250563
Alignment:
Q  154 ggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||| ||||||| | |||||||||||| |||||| |||| ||| ||  |||| |||||||||||||| || ||||||||    
T  25250480 ggtaaccttggcacaactggtaaagttgttgtcatgtgactggaaggtcacatgttcaagtcctggaaacagcctattgtgtaa 25250563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 300 - 351
Target Start/End: Complemental strand, 27468142 - 27468091
Alignment:
Q  300 tcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    |||||||||||||| |||||| | ||||||||||||||||| ||||| ||||    
T  27468142 tcttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt 27468091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Original strand, 45071243 - 45071306
Alignment:
Q  174 taaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| ||||||||| | ||| |||||||| ||| |||||||||| |||||||||||    
T  45071243 taaagttgttgtcatgtgattgtaaggtcacgggttcaagttctggaaacagcctcttgtgtaa 45071306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 2626474 - 2626560
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||  | |||||||||||| ||||||  | | ||| ||||||||| ||||||||||||| |||||||||||    
T  2626474 aggggtaaccttggcgcaattggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 2626560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 17823531 - 17823617
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||| ||| || |||| | |||||||||||| ||||||  | | ||| ||||||||| ||||||||||||| |||||||||||    
T  17823531 aggggtaatcttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 17823617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 18164939 - 18164853
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||| ||| || |||| | | |||||||||| |||||| || | ||| ||||||||| ||||||||||||| |||||||||||    
T  18164939 aggggtaatcttggcgcaaccggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 18164853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 259 - 293
Target Start/End: Original strand, 28873242 - 28873276
Alignment:
Q  259 aatagggtaaggctgcgtacaatacaccaaatgat 293  Q
    |||||||||||| ||||||||||||||||||||||    
T  28873242 aatagggtaaggttgcgtacaatacaccaaatgat 28873276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 240 - 289
Target Start/End: Original strand, 43942348 - 43942398
Alignment:
Q  240 aaacagcctcttgtat-aaaaatagggtaaggctgcgtacaatacaccaaa 289  Q
    |||||||||||| | | ||||| ||||||||||||||||||||||||||||    
T  43942348 aaacagcctcttatgtcaaaaacagggtaaggctgcgtacaatacaccaaa 43942398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 242 - 291
Target Start/End: Complemental strand, 23286432 - 23286384
Alignment:
Q  242 acagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatg 291  Q
    |||||||||||| |||||  ||||||| ||||||||||||||||||||||    
T  23286432 acagcctcttgtgtaaaac-agggtaaagctgcgtacaatacaccaaatg 23286384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 336
Target Start/End: Complemental strand, 42083813 - 42083712
Alignment:
Q  237 tggaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    |||||||||||| |||| |||||| | ||| ||||||||||||| || |||||| || | ||||| ||||||| |||||  ||| ||| |||||||||||    
T  42083813 tggaaacagccttttgtgtaaaaaatggggcaaggctgcgtacagtataccaaaatggtgggaccccttcccgaaccctgtgtacgtgggagctttagtg 42083714  T
Q  335 ca 336  Q
    ||    
T  42083713 ca 42083712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 17250991 - 17250888
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||| ||||||||||| ||||||  ||| |||||| |||||||||||||||  |||| | |||||  |||||| ||||| ||||||   ||||||||||    
T  17250991 tggaagcagcctcttgtgtaaaaaacaggttaaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaaggagctttagt 17250892  T
Q  334 gcac 337  Q
    ||||    
T  17250891 gcac 17250888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 66; Significance: 6e-29; HSPs: 69)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 22609809 - 22609918
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||| | |||||| | |||||| ||||||    
T  22609809 tggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgca 22609908  T
Q  337 ccggattgcc 346  Q
    |||| |||||    
T  22609909 ccgggttgcc 22609918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 237 - 357
Target Start/End: Complemental strand, 40272926 - 40272805
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||| |||||||| ||||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | ||||||||||||    
T  40272926 tggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgc 40272827  T
Q  336 accggattgcctttttatatga 357  Q
    ||||| ||||| |||| |||||    
T  40272826 accgggttgcccttttttatga 40272805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 240 - 339
Target Start/End: Complemental strand, 6411932 - 6411833
Alignment:
Q  240 aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg 339  Q
    |||||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||| |||||| |||| | |||||| | ||||||||||||||||    
T  6411932 aaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcaccg 6411833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 237 - 352
Target Start/End: Complemental strand, 29366836 - 29366718
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||||||||||  |||||||||||||||||||||||||||  ||| | ||||| ||||||||||||| |||||||| ||||||||||    
T  29366836 tggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttagt 29366737  T
Q  334 gcaccggattgccttttta 352  Q
    |||| || ||||| |||||    
T  29366736 gcactgggttgccctttta 29366718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 54484733 - 54484849
Alignment:
Q  237 tggaaacagcctcttgtataaaaatag--ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    ||||||||||||||||| |||||| |   |||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | |||||||||||    
T  54484733 tggaaacagcctcttgtgtaaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg 54484832  T
Q  335 caccggattgccttttt 351  Q
    |||||| ||||| ||||    
T  54484833 caccgggttgccctttt 54484849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 237 - 353
Target Start/End: Complemental strand, 13628906 - 13628787
Alignment:
Q  237 tggaaacagcctcttgtataa-aaatagggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| ||| ||| |||||||||||||||||||||||||||  ||| | ||||| ||||||||||||| |||||| | ||||||||||    
T  13628906 tggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagt 13628807  T
Q  334 gcaccggattgcctttttat 353  Q
    ||||||| ||||| ||||||    
T  13628806 gcaccgggttgcccttttat 13628787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 239 - 354
Target Start/End: Original strand, 16735486 - 16735601
Alignment:
Q  239 gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    |||||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| |||||||||| || |||||| |  ||||| |||||||     
T  16735486 gaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcact 16735585  T
Q  339 ggattgcctttttata 354  Q
    || ||||| |||||||    
T  16735586 gggttgcccttttata 16735601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 26869750 - 26869864
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||||||||| || |||||| |||||||||||||||||||||||||||||| | ||||| ||| ||||||| | |||||| | ||||||| |||||    
T  26869750 tggaaacagcctctggtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttgccggaccatgcgtatgcgggagctttggtgca 26869849  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||| ||||    
T  26869850 ccgggttgccctttt 26869864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 22123029 - 22122921
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||| ||||||| |||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| ||||||| |||||||    
T  22123029 tggaaacagtctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgagagctctagtgca 22122931  T
Q  337 ccggattgcc 346  Q
    |||| |||||    
T  22122930 ccgggttgcc 22122921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 243 - 351
Target Start/End: Original strand, 15797271 - 15797378
Alignment:
Q  243 cagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggat 342  Q
    ||||||||||| |||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||||| ||||| ||||||||||| |    
T  15797271 cagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggt 15797369  T
Q  343 tgccttttt 351  Q
    |||| ||||    
T  15797370 tgccctttt 15797378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 1217133 - 1217246
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  ||||||||||||||||||||||||||||||   ||||| ||||||||||||| | |||| | ||||| |||||||    
T  1217133 tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggcgggaccccttcccggaccctgcatatgcgggagctctagtgca 1217231  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||| ||||    
T  1217232 ccgggttgccctttt 1217246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 31592892 - 31593000
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  |||||||||||||||||||||||||||||| | ||||  ||||||||||||| | |||| | ||||| |||||||    
T  31592892 tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggactccttcccggaccctgcatatgcgggagctctagtgca 31592990  T
Q  337 ccggattgcc 346  Q
    |||| |||||    
T  31592991 ccgggttgcc 31593000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 240 - 313
Target Start/End: Original strand, 47624088 - 47624161
Alignment:
Q  240 aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct 313  Q
    |||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| |||||||||||||    
T  47624088 aaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct 47624161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 45948952 - 45948848
Alignment:
Q  237 tggaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||| |||||||| |||||| |||||||||||||| ||||||||||||| || | ||||| |||| |||||||| |||||| | ||||||||||||    
T  45948952 tggaaacaacctcttgtgtaaaaaatagggtaaggctgcatacaatacaccaattggtgggaccccttctcggaccctgcgtatgcgggagctttagtgc 45948853  T
Q  336 accgg 340  Q
    |||||    
T  45948852 accgg 45948848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 239 - 346
Target Start/End: Original strand, 39203561 - 39203667
Alignment:
Q  239 gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||||||||||||| |||||  ||||||||| |||||||||||||||||||| | ||||| ||||||||||| | | |||| | |||||||||||||||    
T  39203561 gaaacagcctcttgtgtaaaac-agggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccttgcatatgcgggagctttagtgcacc 39203659  T
Q  339 ggattgcc 346  Q
    || |||||    
T  39203660 gggttgcc 39203667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 46421151 - 46421033
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagcttt-ag 332  Q
    ||||||||||||||||| ||||||  ||||||||||||||||||||||||||  |||| | ||||| ||||||||||||| |||||| | ||||||| ||    
T  46421151 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttaag 46421052  T
Q  333 tgcaccggattgccttttt 351  Q
    |||||||| ||||| ||||    
T  46421051 tgcaccggtttgccctttt 46421033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 237 - 338
Target Start/End: Original strand, 26573170 - 26573272
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||| ||| ||||||  ||||||||||||||||||||||||||| || | ||||| | ||||||||||| |||||| | ||||||||||||    
T  26573170 tggaaacagcctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaattggtgggaccccatcccggaccctgcgtatgcgtgagctttagtgc 26573269  T
Q  336 acc 338  Q
    |||    
T  26573270 acc 26573272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 34420758 - 34420656
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    ||||||||||||||||| ||||||  ||||||||||||||||| |||||||||| || | ||||| ||||||||||| | |||||||| |||||||||||    
T  34420758 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtaccatacaccaaaatggtgggaccccttcccggaccttgcgtatgtgggagctttagtg 34420659  T
Q  335 cac 337  Q
    |||    
T  34420658 cac 34420656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 257 - 340
Target Start/End: Complemental strand, 34771457 - 34771374
Alignment:
Q  257 aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    |||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| |||||||||||    
T  34771457 aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg 34771374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 13730718 - 13730601
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| ||||||  |||||||||||| ||||||||||||||  ||| | ||||| ||||||||||||  | |||| | ||||||||||    
T  13730718 tggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagt 13730619  T
Q  334 gcaccggattgccttttt 351  Q
    ||||||| ||||| ||||    
T  13730618 gcaccgggttgccctttt 13730601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 237 - 334
Target Start/End: Original strand, 33926126 - 33926224
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacacca-aatgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    |||||| |||||||||| |||||| |||||||||||| ||||||||||||| |||| | ||||| ||||| ||||||| | |||| |||||||||||||    
T  33926126 tggaaatagcctcttgtgtaaaaacagggtaaggctgtgtacaatacaccataatggtgggaccccttcctggaccctgcatatgcgagagctttagtg 33926224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 240 - 346
Target Start/End: Complemental strand, 45786327 - 45786218
Alignment:
Q  240 aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacc--aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||||||||| ||||||  |||||||||||||||||||||||||  ||||| | ||||| ||||||||||||| || |||   |||||||||||||    
T  45786327 aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgca 45786228  T
Q  337 ccggattgcc 346  Q
    |||| |||||    
T  45786227 ccgggttgcc 45786218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 49013589 - 49013472
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| ||||||  ||||||||||||||||||||||||||  |||| | ||||| ||||||||||||  | || | | ||||||||||    
T  49013589 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagt 49013490  T
Q  334 gcaccggattgccttttt 351  Q
    ||||||| ||||| ||||    
T  49013489 gcaccgggttgccctttt 49013472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 265 - 351
Target Start/End: Complemental strand, 52926304 - 52926218
Alignment:
Q  265 gtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    ||||||||||||||||||||||||||| | ||||  ||||||||||||| |||||| | ||||||||| ||||||| ||||| ||||    
T  52926304 gtaaggctgcgtacaatacaccaaatggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctttt 52926218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 338
Target Start/End: Complemental strand, 10795539 - 10795435
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacacc--aaatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| ||||| | |||||||||||||||||||||||||  ||||| | ||||| ||||| ||||||| |||||| | |||||| |||    
T  10795539 tggaaacagcctcttgtgtaaaagacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagt 10795440  T
Q  334 gcacc 338  Q
    |||||    
T  10795439 gcacc 10795435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 53996680 - 53996575
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    |||||||| |||||||| ||||||  ||||||||||||| |||||||||||||| || | ||||| |||||| ||| || |||||||| |||||||||||    
T  53996680 tggaaacaacctcttgtgtaaaaaacagggtaaggctgcttacaatacaccaaaatggtgggaccccttccctgacactgcgtatgtgggagctttagtg 53996581  T
Q  335 caccgg 340  Q
    ||||||    
T  53996580 caccgg 53996575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 237 - 352
Target Start/End: Complemental strand, 12914149 - 12914033
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||||| ||||||  |||||||||| ||||||||||||||||||| |  |||| |||||| |||||| | |||| | |||||| | |||    
T  12914149 tggaaacagcctcttgtgtaaaaaacagggtaaggcggcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgcgggagcttcaatgc 12914050  T
Q  336 accggattgccttttta 352  Q
    ||||| ||||| |||||    
T  12914049 accgggttgccctttta 12914033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 14987000 - 14987106
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| ||||||  ||||||||||||||||||||||||||  |||| | |||||  |||||||||| | | |||| | ||||||||||    
T  14987000 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcgggagctttagt 14987099  T
Q  334 gcaccgg 340  Q
    |||||||    
T  14987100 gcaccgg 14987106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 338
Target Start/End: Complemental strand, 54374460 - 54374357
Alignment:
Q  237 tggaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    |||||||| |||||||| |||||| ||||||||||||||||||||| |||| ||||| | ||||| ||||||||||||| | |||| | ||||||||||     
T  54374460 tggaaacaacctcttgtgtaaaaaatagggtaaggctgcgtacaatccaccaaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtt 54374361  T
Q  335 cacc 338  Q
    ||||    
T  54374360 cacc 54374357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 13730784 - 13730698
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||| |||||||||||    
T  13730784 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 13730698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 256 - 346
Target Start/End: Complemental strand, 353445 - 353353
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc 346  Q
    ||||| ||||||||||||||||||||||||||  |||| | ||||| ||||||||||||  | |||| | ||||||||||||||||| |||||    
T  353445 aaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcc 353353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 151 - 235
Target Start/End: Complemental strand, 52926390 - 52926305
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgta 235  Q
    |||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||| ||||||||||    
T  52926390 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgta 52926305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 516452 - 516570
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgatag---gacctcttcccggaccctacgtatgtgagagctttag 332  Q
    ||||||||||||||||| ||||||  |||||||||||||| |||||| ||||||  || |   |||| |||||| |||||| |||||| | |||||||||    
T  516452 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgcacaataaaccaaaaaatggcgggaccccttccccgaccctgcgtatgcgggagctttag 516551  T
Q  333 tgcaccggattgccttttt 351  Q
    |||||||| ||||| ||||    
T  516552 tgcaccgggttgccctttt 516570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 7943033 - 7943148
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||||| |||||| ||||||  |||||||| |||||||||||||| |||||| | ||| | ||| || |||| | |||||| | ||||||||||||    
T  7943033 tggaaacagcatcttgtctaaaaaacagggtaagactgcgtacaatacatcaaatggtgggatccctttccagaccatgcgtatgcgggagctttagtgc 7943132  T
Q  336 accggattgccttttt 351  Q
    || || ||||||||||    
T  7943133 actgggttgccttttt 7943148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 269 - 352
Target Start/End: Complemental strand, 25517251 - 25517168
Alignment:
Q  269 ggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttta 352  Q
    ||||||||||||||||| ||||| | ||||| ||||||||| ||| ||||||   ||||||||||||||||| ||||| |||||    
T  25517251 ggctgcgtacaatacacaaaatggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgccctttta 25517168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 7697065 - 7696979
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| |  | ||| ||||||||| |||||||||||||||||||||||||    
T  7697065 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagtctcttgtgtaa 7696979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 237 - 331
Target Start/End: Complemental strand, 8247803 - 8247706
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagcttta 331  Q
    ||||||||||||||||| ||||||  ||||||||| ||||||||||||||||  |||| | ||||  ||||||||||||| |||||| | ||||||||    
T  8247803 tggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggactccttcccggaccctgcgtatgcgggagcttta 8247706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 8247869 - 8247783
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| |||||||||||    
T  8247869 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 8247783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 243 - 320
Target Start/End: Original strand, 9276313 - 9276390
Alignment:
Q  243 cagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatg 320  Q
    ||||||||||| ||||||  |||||||||||||||||||||||||||||| | |||||  |||||||||||| ||||||    
T  9276313 cagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggt-ggaccctttcccggaccctgcgtatg 9276390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 10870131 - 10870045
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| |||||||||||    
T  10870131 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 10870045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 237 - 291
Target Start/End: Original strand, 31831242 - 31831295
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatg 291  Q
    ||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||    
T  31831242 tggaaacagcctcttgtgtaaaa-tagggtaaggctgcatacaatacaccaaatg 31831295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 52428591 - 52428480
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgatag-------gacctcttcccggaccctacgtatgtgagagct 328  Q
    ||||| ||||||||||| ||||| | |||||||||||||||||||||||||||||  | |        ||| |||| ||||||||||||||||| |||||    
T  52428591 tggaagcagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatagtggaaccccaaaccccttctcggaccctacgtatgtgggagct 52428492  T
Q  329 ttagtgcaccgg 340  Q
    ||||||||||||    
T  52428491 ttagtgcaccgg 52428480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 7696999 - 7696902
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||| ||||||| |||||  |||||||||||||||||||||||||||||     | || |||||||||| || | |||||| ||||| |||||||    
T  7696999 tggaaacagtctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaat-----ggccccttcccggacactgcatatgtgggagctctagtgca 7696906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 4495844 - 4495758
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||||||||| |||| | |||||||||||| |||||| |||| ||| |||||||| ||||||| ||| || || ||||||||    
T  4495844 aggggtaaccttcgcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctgaaaatagcctattgtgtaa 4495758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 244 - 351
Target Start/End: Complemental strand, 44403663 - 44403554
Alignment:
Q  244 agcctcttgtataaaa-atagggtaaggctgcgtacaatac-accaaatgataggacctcttcccggaccctacgtatg-tgagagctttagtgcaccgg 340  Q
    |||||||||| ||||| | | |||||||||||| | ||||| || ||||| | ||||| |||||||||||||||||||| ||| ||||||||||||||||    
T  44403663 agcctcttgtgtaaaagacaaggtaaggctgcggagaataccacaaaatggtgggaccccttcccggaccctacgtatgctga-agctttagtgcaccgg 44403565  T
Q  341 attgccttttt 351  Q
      |||||||||    
T  44403564 gctgccttttt 44403554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 237 - 288
Target Start/End: Complemental strand, 45620943 - 45620890
Alignment:
Q  237 tggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacaccaa 288  Q
    ||||||||||||||||| |||||| |  ||||||||||||||||||||||||||    
T  45620943 tggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaa 45620890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 46421217 - 46421131
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| |  | ||| ||||||||| ||||||||||||| |||||||||||    
T  46421217 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 46421131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 239 - 340
Target Start/End: Complemental strand, 50625065 - 50624963
Alignment:
Q  239 gaaacagcctcttgtata-aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac 337  Q
    ||||||||||||||| || |||| |||||||||  |||||||||||||||  || | ||||  ||||| || |||| |||| ||| ||||||||||||||    
T  50625065 gaaacagcctcttgtgtataaaaaagggtaaggtagcgtacaatacaccatttggtgggacgccttcctgggccctgcgtaagtgggagctttagtgcac 50624966  T
Q  338 cgg 340  Q
    |||    
T  50624965 cgg 50624963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 5173834 - 5173718
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    |||||||| |||||||| |||||| |  |||||| ||| | ||||||||||||  || | || || ||||||||||| | |||||| | |||||||||||    
T  5173834 tggaaacaacctcttgtgtaaaaacaaagtaaggttgcatgcaatacaccaaaaatggtggggccccttcccggaccttgcgtatgcgggagctttagtg 5173735  T
Q  335 caccggattgccttttt 351  Q
    |||||| ||||| ||||    
T  5173734 caccgggttgccctttt 5173718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 349
Target Start/End: Complemental strand, 43114984 - 43114869
Alignment:
Q  237 tggaaacagcctcttgtataaaaata--gggtaagg-ctgcgtacaatacaccaaatgataggacctcttcccggaccc-tacgtatgtgagagctttag 332  Q
    ||||||||||||||||| |||||| |  |||||||| || | |||||||||||||||| | ||||| ||||| |||||| | |||||| | |||||||||    
T  43114984 tggaaacagcctcttgtgtaaaaaaacagggtaagggctacctacaatacaccaaatggtgggacc-cttcctggacccctgcgtatgcgggagctttag 43114886  T
Q  333 tgcaccggattgccttt 349  Q
    ||||  |||||||||||    
T  43114885 tgcattggattgccttt 43114869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 293 - 353
Target Start/End: Complemental strand, 10484673 - 10484613
Alignment:
Q  293 taggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcctttttat 353  Q
    ||||||| ||||| ||||||| |||||| | ||||||||||||||||| ||||| ||||||    
T  10484673 taggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttat 10484613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 237 - 277
Target Start/End: Complemental strand, 10870065 - 10870025
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgta 277  Q
    ||||||||||||||||| |||||| ||||||||||||||||    
T  10870065 tggaaacagcctcttgtgtaaaaacagggtaaggctgcgta 10870025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 267 - 338
Target Start/End: Original strand, 25944543 - 25944615
Alignment:
Q  267 aaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||||| |||||||||||| ||||| | ||||| |||||| |||||| |||||||| ||||||||| |||||    
T  25944543 aaggctgagtacaatacaccaaaatggtgggaccccttccctgaccctgcgtatgtgggagctttagcgcacc 25944615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 244 - 355
Target Start/End: Original strand, 26292382 - 26292493
Alignment:
Q  244 agcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggatt 343  Q
    |||||||||| |||||  |||||||| | |||||| |||||||||||||| ||| | ||||||| ||||| | |||| | || || ||||||||||| ||    
T  26292382 agcctcttgtgtaaaac-agggtaagaccgcgtacgatacaccaaatgatgggatcccttcccgaaccctgcatatgcgggaactctagtgcaccgggtt 26292480  T
Q  344 g-cctttttatat 355  Q
    | |||||||||||    
T  26292481 gtcctttttatat 26292493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 256 - 291
Target Start/End: Complemental strand, 4495758 - 4495723
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaatg 291  Q
    ||||| ||||||||||||||||||||||||||||||    
T  4495758 aaaaacagggtaaggctgcgtacaatacaccaaatg 4495723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 295 - 338
Target Start/End: Complemental strand, 45288110 - 45288067
Alignment:
Q  295 ggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||||||||||||||||| ||||||  ||||||||||||||||    
T  45288110 ggacctcttcccggaccctgcgtatgcaagagctttagtgcacc 45288067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 1217067 - 1217153
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | ||||||||| || |||| | || | ||| ||||||||| ||||||||||||| |||||||||||    
T  1217067 aggggtaaccttggcgcaactggtaaagttgtagtcatgtcactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 1217153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 285 - 351
Target Start/End: Original strand, 10300583 - 10300649
Alignment:
Q  285 ccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    ||||||||| ||||  |||||| ||||||||||||| | |||||||| || || |||||||||||||    
T  10300583 ccaaatgatgggactccttcccagaccctacgtatgcgggagctttaatgtactggattgccttttt 10300649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 237 - 330
Target Start/End: Complemental strand, 30928261 - 30928167
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttt 330  Q
    ||||||||||||||||| ||||||  | ||||||| || ||| |||||||||| ||   ||||| ||||||||||||| | |||||| |||||||    
T  30928261 tggaaacagcctcttgtgtaaaaaacaaggtaaggttgtgtaaaatacaccaattggcgggaccccttcccggaccctgcatatgtgggagcttt 30928167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 39203493 - 39203579
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| |||||||   |||||||||||| |||||| || | ||| || ||||| |||||| ||||||| |||||||||||    
T  39203493 aggggtaaccttggcacaacttgtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtccttgaaacagcctcttgtgtaa 39203579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 272 - 340
Target Start/End: Complemental strand, 829521 - 829452
Alignment:
Q  272 tgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    |||||||||||||||||| || | ||||| ||||||| ||||| ||||||   |||||||||||||||||    
T  829521 tgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcaccgg 829452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 289
Target Start/End: Complemental strand, 45139592 - 45139539
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaa 289  Q
    |||||||| |||||||| ||||| | ||||||||||||| ||||||||||||||    
T  45139592 tggaaacaacctcttgtgtaaaacacagggtaaggctgcatacaatacaccaaa 45139539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 279 - 336
Target Start/End: Complemental strand, 46170038 - 46169981
Alignment:
Q  279 aatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||| |||||||| ||||||| ||||||||||||| | |||||| |||||| ||||||    
T  46170038 aataaaccaaatggtaggaccccttcccggaccctgcatatgtgggagcttcagtgca 46169981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 302 - 351
Target Start/End: Original strand, 47624208 - 47624257
Alignment:
Q  302 ttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    |||||||||||| |||||| | ||||||||||||||||| ||||| ||||    
T  47624208 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt 47624257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 313
Target Start/End: Complemental strand, 8410979 - 8410904
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct 313  Q
    ||||||| ||||| |||| ||||| |||||||||||||  |||||||||||| || | |||||||||| | ||||||    
T  8410979 tggaaactgcctcgtgta-aaaaacagggtaaggctgctcacaatacaccaactggtgggacctcttctcagaccct 8410904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 288
Target Start/End: Original strand, 9607246 - 9607298
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa 288  Q
    ||||||||||||||||  ||||||  |||||||||||||||| ||||||||||    
T  9607246 tggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtagaatacaccaa 9607298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 290
Target Start/End: Original strand, 21875056 - 21875111
Alignment:
Q  237 tggaaacagcctcttgtat--aaaaatagggtaaggctgcgtacaatacaccaaat 290  Q
    |||||||| |||||||| |  ||||| |||||||||||||||||||||||| ||||    
T  21875056 tggaaacaacctcttgtgttaaaaaagagggtaaggctgcgtacaatacactaaat 21875111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 295 - 355
Target Start/End: Original strand, 30452897 - 30452957
Alignment:
Q  295 ggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcctttttatat 355  Q
    ||||| ||||||||||||| | |||| | ||||| ||||||||||| ||||| ||||||||    
T  30452897 ggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttatat 30452957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 240 - 350
Target Start/End: Original strand, 55401222 - 55401334
Alignment:
Q  240 aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac 337  Q
    |||||||||||||| ||||||  ||| |||| ||||||| |||||||| ||||| | ||||| |||| |||||| | |||||| | |||||||  |||||    
T  55401222 aaacagcctcttgtgtaaaaaacaggttaagactgcgtataatacaccaaaatggtgggaccccttctcggaccttccgtatgcgggagcttttttgcac 55401321  T
Q  338 cggattgcctttt 350  Q
    |||  ||||||||    
T  55401322 cgggctgcctttt 55401334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 64; Significance: 9e-28; HSPs: 3)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 46852 - 46967
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||| |||||||| ||||| ||||||||||| |||||||||||||||||||| | ||||| ||||||||||||| |||||| | ||||||||||||    
T  46852 tggaaacaacctcttgtgtaaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgc 46951  T
Q  336 accggattgccttttt 351  Q
    ||||| ||||| ||||    
T  46952 accgggttgccctttt 46967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 241 - 336
Target Start/End: Complemental strand, 24882 - 24786
Alignment:
Q  241 aacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||| ||||||  ||||||||||||||||||| |||||||||| | ||||| ||||||| ||||| |||||| | |||||||||||||    
T  24882 aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaacacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgca 24786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 237 - 354
Target Start/End: Original strand, 43680 - 43797
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctc-ttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||||| |||||| |||||  ||| |||||||||||||||||||||||||| | ||||| | ||| |||||||| | |||| | ||||| ||||||    
T  43680 tggaaacagcgtcttgtgtaaaacaagg-taaggctgcgtacaatacaccaaatggtgggacccctttctcggaccctgcatatgcgggagctctagtgc 43778  T
Q  336 accggattgcctttttata 354  Q
    || |  ||||| |||||||    
T  43779 actgagttgcccttttata 43797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 64; Significance: 9e-28; HSPs: 45)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 24448911 - 24449026
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||||||| |||| ||||| |||||||||||||||||||||||||||||||| | ||||| ||||||||||||| ||||||   ||||||||||||    
T  24448911 tggaaacagccttttgtgtaaaaaatagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgc 24449010  T
Q  336 accggattgccttttt 351  Q
    ||||| ||||| ||||    
T  24449011 accgggttgccctttt 24449026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 237 - 352
Target Start/End: Original strand, 38879602 - 38879720
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||||||||||  |||||||||||||||||||||||||||  ||| | ||||| ||||||||||||| |||||| | ||||||||||    
T  38879602 tggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagt 38879701  T
Q  334 gcaccggattgccttttta 352  Q
    ||||||| ||||| |||||    
T  38879702 gcaccgggttgccctttta 38879720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 237 - 352
Target Start/End: Original strand, 41014340 - 41014455
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||| ||||||  | |||| | |||||||||||||    
T  41014340 tggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcctggaccccgcatatgcgggagctttagtgca 41014439  T
Q  337 ccggattgccttttta 352  Q
    |||| ||||| |||||    
T  41014440 ccgggttgccctttta 41014455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 352
Target Start/End: Original strand, 32703445 - 32703559
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| |||||||    
T  32703445 tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 32703543  T
Q  337 ccggattgccttttta 352  Q
    |||| ||||| |||||    
T  32703544 ccgggttgccctttta 32703559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 7368419 - 7368527
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  ||||||||||||||||||||||||||| || | ||||| ||||||||||||| | |||||| ||||| |||||||    
T  7368419 tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaattggtgggaccccttcccggaccctgcatatgtgggagctctagtgca 7368517  T
Q  337 ccggattgcc 346  Q
    |||| |||||    
T  7368518 ccgggttgcc 7368527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 240 - 338
Target Start/End: Complemental strand, 7097870 - 7097772
Alignment:
Q  240 aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    |||||||||||||| |||||| ||||||||| |||||||||||||||||||| |  |||| ||||||| ||||| |||||| | |||||||||||||||    
T  7097870 aaacagcctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaatggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 7097772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 237 - 353
Target Start/End: Complemental strand, 4619220 - 4619101
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    |||||| |||||||||| ||||||  |||||||||||||||||||||||||||  ||| | ||||| ||||||||||||  | |||| ||||||||||||    
T  4619220 tggaaatagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagt 4619121  T
Q  334 gcaccggattgcctttttat 353  Q
    ||||||| ||||| ||||||    
T  4619120 gcaccgggttgcccttttat 4619101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 241 - 340
Target Start/End: Complemental strand, 16880757 - 16880657
Alignment:
Q  241 aacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg 339  Q
    ||||||||||||| ||||||  |||||||||||||||||||||||||||||| |  |||| ||||||||||| | |||||| | ||||||||||||||||    
T  16880757 aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccg 16880658  T
Q  340 g 340  Q
    |    
T  16880657 g 16880657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 19143056 - 19142956
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||| |||||||| |||||| |||||||||||||||||| ||||||||||| | ||||| ||||||||||| | |||||| | ||| |||||||||    
T  19143056 tggaaacaacctcttgtgtaaaaacagggtaaggctgcgtacagtacaccaaatggtgggaccccttcccggaccatgcgtatgcgggagatttagtgca 19142957  T
Q  337 c 337  Q
    |    
T  19142956 c 19142956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 237 - 352
Target Start/End: Original strand, 27328773 - 27328891
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||| ||||||| ||||||  |||||||||||||||||||||||||||  ||| | ||||| ||||||| ||||| |||||| | |||||||| |    
T  27328773 tggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccgaaccctgcgtatgcgggagctttaat 27328872  T
Q  334 gcaccggattgccttttta 352  Q
    ||| |||||||||||||||    
T  27328873 gcatcggattgccttttta 27328891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 8170096 - 8169983
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||||||| |||| |||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||| || ||||||    
T  8170096 tggaaacagccttttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagtttcagtgca 8169998  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||| ||||    
T  8169997 ccgggttgccctttt 8169983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 35710334 - 35710447
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| ||||| |||||||||||||||| |||||||||||||| | ||||| ||||||||| | | | |||| | ||||| |||||||    
T  35710334 tggaaacagcctcttgtgtaaaa-tagggtaaggctgcgttcaatacaccaaatggtgggaccccttcccggaacatgcatatgcgggagctctagtgca 35710432  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||| ||||    
T  35710433 ccgggttgccctttt 35710447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 13801883 - 13801771
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||| ||||||||||| ||||||  ||||||||||||||||||||||||||  |||| | ||||| ||||||||||||  | |||| ||||||||||||    
T  13801883 tggaagcagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagt 13801784  T
Q  334 gcaccggattgcc 346  Q
    ||||||| |||||    
T  13801783 gcaccgggttgcc 13801771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 43574627 - 43574731
Alignment:
Q  237 tggaaacagcctcttgtata-aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||  ||||||| || |||| ||||||||||||||||||||| |||||||| | ||||| ||||||||||||| |||||| | ||||||||| ||    
T  43574627 tggaaacaatctcttgtgtagaaaacagggtaaggctgcgtacaatataccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagagc 43574726  T
Q  336 accgg 340  Q
    |||||    
T  43574727 accgg 43574731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 239 - 320
Target Start/End: Original strand, 2838802 - 2838883
Alignment:
Q  239 gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatg 320  Q
    |||||||| |||||| |||||| |||||||||||||||||||||||||||||| | ||| | |||| |||||||| ||||||    
T  2838802 gaaacagcatcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggatcccttctcggaccctgcgtatg 2838883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 275 - 352
Target Start/End: Original strand, 16957374 - 16957451
Alignment:
Q  275 gtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttta 352  Q
    ||||||||||||||||| | ||||| ||||||||||||| |||||| | ||||||||||||||||| ||||| |||||    
T  16957374 gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta 16957451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 29334416 - 29334521
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca-aatgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    ||||||||||||||||| ||||||  | |||||||||||||||||||||||| |||| | |||||  |||||||||||| |||||||| || ||||| ||    
T  29334416 tggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccagaatggtgggacccattcccggaccctgcgtatgtgggatctttaatg 29334515  T
Q  335 caccgg 340  Q
    ||||||    
T  29334516 caccgg 29334521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 262 - 346
Target Start/End: Complemental strand, 34154902 - 34154818
Alignment:
Q  262 agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc 346  Q
    |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| |  |||| ||||||||||| |||||    
T  34154902 agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcc 34154818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 43334223 - 43334340
Alignment:
Q  237 tggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacacc--aaatgataggacctcttcccggaccctacgtatgtgagagctttag 332  Q
    ||||||||||||| ||| |||||| |  ||||||||||||||||||||||||  ||||| | ||||| ||||||||||||| || ||| | |||||||||    
T  43334223 tggaaacagcctcctgtgtaaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcg-atgcgggagctttag 43334321  T
Q  333 tgcaccggattgccttttt 351  Q
    |||||||| ||||| ||||    
T  43334322 tgcaccgggttgccctttt 43334340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 336
Target Start/End: Complemental strand, 5873435 - 5873336
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| ||||||||||||||||||  ||||| |||||||| || | ||||  || ||||||| || |||||| | |||||||||||||    
T  5873435 tggaaacagcctcttgtgtaaaaatagggtaaggctaagtacactacaccaattggtgggactcctccccggacactgcgtatgcgggagctttagtgca 5873336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 240 - 350
Target Start/End: Original strand, 30006349 - 30006460
Alignment:
Q  240 aaacagcctcttgtataaa-aatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||| |||||| |||||| || |||||||||||| ||||| ||||| ||||| | ||||| ||||||||  |||| ||||| | |||||||||||||||    
T  30006349 aaacaacctcttatataaacaacagggtaaggctgtgtacattacactaaatggtgggaccccttcccggggcctatgtatgcgggagctttagtgcacc 30006448  T
Q  339 ggattgcctttt 350  Q
    || |||||||||    
T  30006449 gggttgcctttt 30006460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 41014274 - 41014360
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||| |||||||||||    
T  41014274 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 41014360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 251 - 340
Target Start/End: Original strand, 3771375 - 3771464
Alignment:
Q  251 tgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    |||| ||||| |||||||||||| | |||||||||||| || | ||||| |||||||||| ||  ||||||| |||||||||||||||||    
T  3771375 tgtaaaaaaacagggtaaggctgtgaacaatacaccaattggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgg 3771464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 241 - 340
Target Start/End: Complemental strand, 209037 - 208937
Alignment:
Q  241 aacagcctcttgtataaaaatagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg 339  Q
    |||| |||||||| |||||| ||||||||||||| | ||||||||| ||||| | ||||| ||||| |||||||  |||||  |||||||||||||||||    
T  209037 aacaacctcttgtgtaaaaacagggtaaggctgcattcaatacaccaaaatggtgggaccccttcctggaccctgggtatgcaagagctttagtgcaccg 208938  T
Q  340 g 340  Q
    |    
T  208937 g 208937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 24448845 - 24448931
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||| || ||||||||    
T  24448845 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagccttttgtgtaa 24448931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 246 - 343
Target Start/End: Original strand, 1850670 - 1850767
Alignment:
Q  246 cctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggatt 343  Q
    |||||||| |||||| ||  ||||| ||||||||||||| |||||| | ||||| ||||| ||||||| || ||| |  |||||||||||||||||||    
T  1850670 cctcttgtgtaaaaacagaataagggtgcgtacaatacatcaaatggtgggaccacttcctggaccctgcggatgcggaagctttagtgcaccggatt 1850767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 20135625 - 20135737
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| ||||||  | ||||||||||||||||||||||||  |||| | ||||| ||||||||||||  | ||||   |||||| |||    
T  20135625 tggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcagt 20135724  T
Q  334 gcaccggattgcc 346  Q
    ||||||| |||||    
T  20135725 gcaccgggttgcc 20135737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 266 - 346
Target Start/End: Original strand, 1565483 - 1565562
Alignment:
Q  266 taaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc 346  Q
    |||||||||||||||| |||||||||   ||||| ||||||||||||| | |||||| |||| |||||||||||| |||||    
T  1565483 taaggctgcgtacaatgcaccaaatggcgggaccccttcccggaccctgcatatgtgggagc-ttagtgcaccgggttgcc 1565562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 153 - 236
Target Start/End: Complemental strand, 22861844 - 22861760
Alignment:
Q  153 gggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||| ||||||| |||||||||||||| |||||| || | ||| |||| ||| |||||| ||| |||||||||||||||    
T  22861844 gggtaaccttggcacaactgataaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaagcagtctcttgtgtaa 22861760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 1405208 - 1405323
Alignment:
Q  237 tggaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||| |||||| |||||||| ||| |||||  |||||||||||||||||||| | |||||  |||| | ||||| | |||| | ||||| |||| |    
T  1405208 tggaaacaacctcttatataaaaaatagagtaagtttgcgtacaatacaccaaatggtgggaccctttcctgaaccctgcatatgcgggagctctagtac 1405307  T
Q  336 accggattgccttttt 351  Q
    ||||||||||| ||||    
T  1405308 accggattgccctttt 1405323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 295 - 346
Target Start/End: Original strand, 25622540 - 25622591
Alignment:
Q  295 ggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc 346  Q
    ||||| ||||||||||||| |||||| | |||||||||||||||||||||||    
T  25622540 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcc 25622591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 256 - 339
Target Start/End: Complemental strand, 12006424 - 12006339
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg 339  Q
    ||||||||||||||||| | ||||||||||||  |||| | ||||| |||||| |||||| | |||| | ||||||||||||||||    
T  12006424 aaaaatagggtaaggctccatacaatacaccaataatggtgggaccccttcccagaccctgcctatgcgggagctttagtgcaccg 12006339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 23974736 - 23974821
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||  |||||||||||    
T  23974736 aggggtaaccttggcgcaacgg-taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaa 23974821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 35710268 - 35710354
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||| | || | ||| ||||||||| ||||||||||||| |||||||||||    
T  35710268 aggggtaaccttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 35710354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 37024734 - 37024648
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| |  |||| | |||||||||||| |||||| || | ||| ||||||||| ||||||||||||| |||||||||||    
T  37024734 aggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 37024648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 232
Target Start/End: Original strand, 38879536 - 38879618
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgt 232  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| |||||||    
T  38879536 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt 38879618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 266 - 338
Target Start/End: Complemental strand, 12477205 - 12477132
Alignment:
Q  266 taaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||||||||||||||||||| ||||| | ||||| |||||||||  || ||||||  ||||||||||||||||    
T  12477205 taaggctgcgtacaatacaccaaaatggtgggaccccttcccggattctgcgtatgcaagagctttagtgcacc 12477132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 271 - 340
Target Start/End: Original strand, 13774921 - 13774990
Alignment:
Q  271 ctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    ||||| |||||||||||||||  |||| | ||| ||||||||| |||||| | |||||||||||||||||    
T  13774921 ctgcgcacaatacaccaaatggcaggatccctttccggaccctgcgtatgcgggagctttagtgcaccgg 13774990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 39801596 - 39801653
Alignment:
Q  295 ggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttta 352  Q
    ||||| |||||| ||||||||||||| | ||||||||||||||||| ||||| |||||    
T  39801596 ggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgccatttta 39801653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 330
Target Start/End: Original strand, 22600501 - 22600569
Alignment:
Q  262 agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttt 330  Q
    |||||||||||| ||||||||||||||||| | ||| | ||||||||| ||| |||||| | |||||||    
T  22600501 agggtaaggctgtgtacaatacaccaaatggtgggatcccttcccggatcctgcgtatgcgggagcttt 22600569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 239 - 291
Target Start/End: Complemental strand, 22907976 - 22907924
Alignment:
Q  239 gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatg 291  Q
    ||||||||||||||| |||||| || |||||| ||| ||||||||||||||||    
T  22907976 gaaacagcctcttgtgtaaaaacagagtaaggttgcatacaatacaccaaatg 22907924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 248 - 351
Target Start/End: Complemental strand, 37226064 - 37225960
Alignment:
Q  248 tcttgtataaaaatagggtaaggctgcgtacaatac-accaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc 346  Q
    |||||||||||||| |||||||  || ||||||||| || ||||| | ||||| ||||||| ||| | ||||||  |||| |||||||||| ||||||||    
T  37226064 tcttgtataaaaattgggtaagaatgtgtacaatacaacaaaatggtgggaccccttcccgaaccatgcgtatgccagaggtttagtgcactggattgcc 37225965  T
Q  347 ttttt 351  Q
     ||||    
T  37225964 ctttt 37225960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 153 - 236
Target Start/End: Original strand, 43334159 - 43334243
Alignment:
Q  153 gggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| ||| |||||||    
T  43334159 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaa 43334243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Original strand, 27328730 - 27328793
Alignment:
Q  174 taaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| |||||| || | ||| || |||||| |||||||||||||||||||||||||    
T  27328730 taaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagtctcttgtgtaa 27328793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 241 - 340
Target Start/End: Original strand, 39301148 - 39301248
Alignment:
Q  241 aacagcctcttgtata-aaaatagggtaaggctgcgtacaatacaccaaat-gataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    |||| |||||||| || |||| ||||||||| |||||| ||| |||||||  | | ||||| ||||||||||||| |||||||| ||| |||||||||||    
T  39301148 aacaacctcttgtgtataaaacagggtaaggatgcgtataatgcaccaaaaaggtgggaccccttcccggaccctccgtatgtgggag-tttagtgcacc 39301246  T
Q  339 gg 340  Q
    ||    
T  39301247 gg 39301248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 62; Significance: 1e-26; HSPs: 69)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 237 - 350
Target Start/End: Complemental strand, 33872023 - 33871910
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||| |||||||| |||||| ||| |||||||||||||||||||||||||| | ||||| |||||| ||||||  ||||| |||||||||||||||    
T  33872023 tggaaacaacctcttgtgtaaaaacaggataaggctgcgtacaatacaccaaatggtgggaccccttcccagaccctgtgtatgcgagagctttagtgca 33871924  T
Q  337 ccggattgcctttt 350  Q
    || | |||||||||    
T  33871923 ccaggttgcctttt 33871910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 19265836 - 19265938
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||| |||||| ||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||||| ||||| |||||| |||||||||||||    
T  19265836 tggatacagccgcttgtgtaaaaagagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgga-cctacatatgtgggagctttagtgca 19265934  T
Q  337 ccgg 340  Q
    ||||    
T  19265935 ccgg 19265938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 352
Target Start/End: Complemental strand, 21172121 - 21172007
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| |||||||    
T  21172121 tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 21172023  T
Q  337 ccggattgccttttta 352  Q
    |||| ||||| |||||    
T  21172022 ccgggttgccctttta 21172007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 18512566 - 18512457
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||| | |||||| |||||||||||||||||||||||||||||||| |||| | ||||| ||||||||||||| |||||| | ||||||| |||||    
T  18512566 tggaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgca 18512467  T
Q  337 ccggattgcc 346  Q
    | || |||||    
T  18512466 ctgggttgcc 18512457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 2541133 - 2541029
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||||| ||||||  ||||||||||||||||| |||||||||||| | ||||| |||||||| |||| |||||| | ||||||||||||    
T  2541133 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtactatacaccaaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgc 2541034  T
Q  336 accgg 340  Q
    |||||    
T  2541033 accgg 2541029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 38604548 - 38604652
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttt-agtgc 335  Q
    ||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |  |||| ||| ||||||||| |||||| | ||||||| |||||    
T  38604548 tggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgagacccctttccggaccctgcgtatgcgggagctttaagtgc 38604647  T
Q  336 accgg 340  Q
    |||||    
T  38604648 accgg 38604652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 19427003 - 19426889
Alignment:
Q  237 tggaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||||| |||||| ||||||||| ||||||||||||||||||||| | ||||| |||| |||||||| | |||| |||||||| |||||    
T  19427003 tggaaacagcctcttgtgtaaaaaatagggtaagactgcgtacaatacaccaaatggtgggacc-cttctcggaccctgcatatgcgagagcttcagtgc 19426905  T
Q  336 accggattgccttttt 351  Q
    ||||| ||||| ||||    
T  19426904 accgggttgccctttt 19426889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 32758282 - 32758395
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  |||||||||||| ||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| |||||||    
T  32758282 tggaaacagcctcttgtgtaaaac-agggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 32758380  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||| ||||    
T  32758381 ccgggttgccctttt 32758395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 34626321 - 34626207
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||| ||| |||||| ||||||||||||||| |||||||||||||| | ||| | ||||||||||||| |||||| | |||||||||| ||    
T  34626321 tggaaacagcctcctgtgtaaaaacagggtaaggctgcgttcaatacaccaaatggtgggatcccttcccggaccctgcgtatgcgggagctttagttca 34626222  T
Q  337 ccggattgccttttt 351  Q
     ||| ||||| ||||    
T  34626221 tcgggttgccctttt 34626207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 42391212 - 42391099
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||||| |||||| |||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| |||||||    
T  42391212 tggaaacagcttcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 42391114  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||| ||||    
T  42391113 ccgggttgccctttt 42391099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 10693185 - 10693077
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| |||||||    
T  10693185 tggaaacagcctcttgtgtaaaag-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 10693087  T
Q  337 ccggattgcc 346  Q
    | || |||||    
T  10693086 ctgggttgcc 10693077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 264 - 351
Target Start/End: Original strand, 7879687 - 7879774
Alignment:
Q  264 ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    |||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | |||||| |||||||||| ||||| ||||    
T  7879687 ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcaccgggttgccctttt 7879774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 38262310 - 38262195
Alignment:
Q  237 tggaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||| ||||||| |||||| || ||||| | ||| |||||||||||||||||| ||||| ||||||| || || |||||| | ||||||||||||    
T  38262310 tggaaacagtctcttgtgtaaaaaatatggtaatgttgcatacaatacaccaaatgatgggaccccttcccgaacactgcgtatgcgggagctttagtgc 38262211  T
Q  336 accggattgccttttt 351  Q
    ||||||||||| ||||    
T  38262210 accggattgccctttt 38262195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 239 - 352
Target Start/End: Original strand, 40463900 - 40464013
Alignment:
Q  239 gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||||| ||||||| ||||||  ||||||||||||||| ||||||||||||| | ||||| |||| |||||||| |||||| | |||||| ||||||||    
T  40463900 gaaacagtctcttgtgtaaaaactgggtaaggctgcgtataatacaccaaatggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcacc 40463999  T
Q  339 ggattgccttttta 352  Q
    |  ||||| |||||    
T  40464000 gagttgccctttta 40464013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 48735234 - 48735126
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||| |||||||| |||||  | |||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| |||||||    
T  48735234 tggaaacaacctcttgtgtaaaac-acggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 48735136  T
Q  337 ccggattgcc 346  Q
    |||| |||||    
T  48735135 ccgggttgcc 48735126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 237 - 339
Target Start/End: Original strand, 23231578 - 23231681
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||| |||||||||| ||||| ||| |||||||||||||| |||||||| |||||| ||||| ||||||| ||||| |||||| |  |||||||||||    
T  23231578 tggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgc 23231677  T
Q  336 accg 339  Q
    ||||    
T  23231678 accg 23231681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 241 - 352
Target Start/End: Complemental strand, 35787378 - 35787267
Alignment:
Q  241 aacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    ||||||||||||| |||||| | ||||||| ||||||||||||||||||||   ||||| ||||||||||| | |||||| | |||||| | ||||||||    
T  35787378 aacagcctcttgtgtaaaaacatggtaaggttgcgtacaatacaccaaatggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgg 35787279  T
Q  341 attgccttttta 352  Q
     ||||| |||||    
T  35787278 gttgccctttta 35787267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 11617702 - 11617592
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||| |||||||| ||||||  |||||||| ||||||||||||||||||||| | ||||| ||||| ||||||| ||||||   || |||||||||    
T  11617702 tggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcaggacctttagtgc 11617603  T
Q  336 accggattgcc 346  Q
    ||||| |||||    
T  11617602 accgggttgcc 11617592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 42805545 - 42805662
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| ||||||  |||||||||||| |||||||||||||  |||| | ||||| ||||||||||||  | |||| | ||||||||||    
T  42805545 tggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagt 42805644  T
Q  334 gcaccggattgccttttt 351  Q
    ||||||| ||||| ||||    
T  42805645 gcaccgggttgccctttt 42805662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 47077967 - 47077854
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||| ||||||| ||||| ||| |||| | |||||||||||||| ||||| | ||||| ||||||  ||||||| |||| | ||||| |||||||    
T  47077967 tggaaacagtctcttgtgtaaaa-tagagtaaagttgcgtacaatacacaaaatggtgggaccccttcccaaaccctacatatgcgggagctctagtgca 47077869  T
Q  337 ccggattgccttttt 351  Q
    |||||||||||||||    
T  47077868 ccggattgccttttt 47077854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 47716480 - 47716592
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| ||||||  ||||||||||||||||||||||||||  |||| | ||||| ||||||||||||  | |||| | ||||||| ||    
T  47716480 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttggt 47716579  T
Q  334 gcaccggattgcc 346  Q
    ||||||| |||||    
T  47716580 gcaccgggttgcc 47716592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 237 - 353
Target Start/End: Complemental strand, 2663047 - 2662933
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| | ||||| |||  | |||||| | |||| | ||||| ||| |||    
T  2663047 tggaaacagcctcttgtgtaaaa-tagggtaaggctgcgtacaatacaccaaatggtgggacc-cttttcagaccctgcatatgcgggagctctagcgca 2662950  T
Q  337 ccggattgcctttttat 353  Q
    ||||||| | |||||||    
T  2662949 ccggattccttttttat 2662933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 351
Target Start/End: Complemental strand, 27889399 - 27889315
Alignment:
Q  267 aaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    ||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | ||||||| || |||||| ||||| ||||    
T  27889399 aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgccctttt 27889315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 1408478 - 1408593
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||| |||||||||| ||||||  | |||||||||| |||||||||| |||||| | ||||| ||||||||||||| ||||||    | ||||||| |    
T  1408478 tggaaatagcctcttgtgtaaaaaacaaggtaaggctgtgtacaatacagcaaatggtgggaccccttcccggaccctgcgtatgcagaatctttagttc 1408577  T
Q  336 accggattgccttttt 351  Q
    ||||||||||||||||    
T  1408578 accggattgccttttt 1408593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 27629655 - 27629770
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||||| ||||||  ||||||||| |||||| ||||||||||||| | ||||| |||||||| |||| | |||| |  ||||| |||||    
T  27629655 tggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtaaaatacaccaaatggtgggaccccttcccgggccctgcatatgcggtagcttcagtgc 27629754  T
Q  336 accggattgccttttt 351  Q
    ||||| ||||| ||||    
T  27629755 accgggttgccctttt 27629770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 35334928 - 35334826
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||| ||| |||| ||||| |||||||| ||| |||||||||||| |||| | ||||| ||||||||||||| ||||||   |||||||||||||    
T  35334928 tggaaacagtctcgtgta-aaaaacagggtaagactgtgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgca 35334830  T
Q  337 ccgg 340  Q
    ||||    
T  35334829 ccgg 35334826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 42798690 - 42798805
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||| ||||||| ||||||  | |||||||||||||||||||||||||||| | |||||  |||||||||||| | |||| | ||||| ||||||    
T  42798690 tggaaacagtctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccctttcccggaccctgcatatgcgggagctatagtgc 42798789  T
Q  336 accggattgccttttt 351  Q
    | ||| ||||| ||||    
T  42798790 atcgggttgccctttt 42798805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 18747507 - 18747612
Alignment:
Q  237 tggaaacagcctcttgtataaaaat--agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    |||||||||||| |||| ||||||   |||||||||||||||| |||||||||| || | ||||| ||||| | ||||| |||||| | |||||||||||    
T  18747507 tggaaacagccttttgtgtaaaaaagcagggtaaggctgcgtataatacaccaattggtgggaccccttcctgaaccctgcgtatgcgggagctttagtg 18747606  T
Q  335 caccgg 340  Q
    ||||||    
T  18747607 caccgg 18747612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 239 - 346
Target Start/End: Original strand, 29907442 - 29907549
Alignment:
Q  239 gaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||| |||||| ||| |||||||||||| ||||||||| ||||| | ||||| | |||||||||||  ||||| | |||||||||||||    
T  29907442 gaaacagcctcttgtgtaaaaaatagtgtaaggctgcgttcaatacaccaaaatggtgggaccccatcccggaccct--gtatgcgggagctttagtgca 29907539  T
Q  337 ccggattgcc 346  Q
    |||| |||||    
T  29907540 ccgggttgcc 29907549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 42798624 - 42798710
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| |||| |||||||||||||||||||||    
T  42798624 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttggaaacagtctcttgtgtaa 42798710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 46354149 - 46354235
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| ||||||||||| ||| |||||||| |||||||||||||  |||||||||||    
T  46354149 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgattggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaa 46354235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 47078033 - 47077947
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| ||||||||| |||||||||||||||||||||||||    
T  47078033 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgtgtaa 47077947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 353
Target Start/End: Complemental strand, 31591221 - 31591106
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||| |||||||| |||||  || ||||||||||||||||||||  ||||| | ||||| ||||||||||| | | |||| | ||||| |||||||    
T  31591221 tggaaacaacctcttgtgtaaaac-agagtaaggctgcgtacaatacaataaatggtgggaccccttcccggaccttgcatatgcgggagctctagtgca 31591123  T
Q  337 ccggattgcctttttat 353  Q
    |||| ||||| ||||||    
T  31591122 ccgggttgcccttttat 31591106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 43557493 - 43557611
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagc-tttag 332  Q
    ||||||||||||||||| ||||||  || |||||||||||||||||||||||  |||| | ||||| | |||||||| || |||||| | |||| |||||    
T  43557493 tggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgggaccccctcccggactctgcgtatgcgggagcttttag 43557592  T
Q  333 tgcaccggattgccttttt 351  Q
    |||||||| ||||| ||||    
T  43557593 tgcaccgggttgccctttt 43557611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 155 - 236
Target Start/End: Complemental strand, 7794682 - 7794600
Alignment:
Q  155 gtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||| || |||| | ||||||||||||||||||| |||| ||| |||||||| |||||||||||||| ||||| |||||    
T  7794682 gtaaccttagcgcaactggtaaagttgttgttatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttatgtaa 7794600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 251 - 345
Target Start/End: Original strand, 25198762 - 25198856
Alignment:
Q  251 tgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgc 345  Q
    |||| ||||| | |||||| | ||||| ||| ||| ||||| ||||| | |||||| |||||| |||||||||||||||||||||||||| ||||    
T  25198762 tgtaaaaaaacaaggtaagaccgcgtataatgcactaaatggtaggatcccttcccagacccttcgtatgtgagagctttagtgcaccgggttgc 25198856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 42805479 - 42805565
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| ||  ||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||| |||||||||||    
T  42805479 aggggtaaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 42805565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 47716414 - 47716500
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| ||||||| |  ||||||||||  |||||| |||| ||| |||||||| |||||||||||||| |||||||||||    
T  47716414 aggggtaaccttggcacaactggaaaagttgttgccatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 47716500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 257 - 346
Target Start/End: Original strand, 11741835 - 11741924
Alignment:
Q  257 aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc 346  Q
    ||||||||||||||||||||||||||||||||||| | ||| | |||||||||  || |  ||| | ||||| ||||||||||| |||||    
T  11741835 aaaatagggtaaggctgcgtacaatacaccaaatggtgggatcccttcccggattctgcacatgcgggagctctagtgcaccgggttgcc 11741924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 330
Target Start/End: Original strand, 13805123 - 13805216
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttt 330  Q
    |||||| ||||||| || |||||   ||||||||||| ||||||||||||||||| | ||||| ||||| ||||||| |||||| | |||||||    
T  13805123 tggaaatagcctctggtgtaaaacaggggtaaggctgtgtacaatacaccaaatggtgggaccacttcctggaccctgcgtatgcgggagcttt 13805216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 256 - 329
Target Start/End: Original strand, 19266491 - 19266564
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctt 329  Q
    ||||| |||||||||||||||||||||||||||||  | ||| | ||||||||||||| |||||| | ||||||    
T  19266491 aaaaacagggtaaggctgcgtacaatacaccaaattgtgggatcccttcccggaccctgcgtatgcgggagctt 19266564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 21566456 - 21566561
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    ||||||| ||||||||| ||||||  || | ||| ||||||||||||||||||| || ||||||| ||||||| ||||| | |||| | |||||||||||    
T  21566456 tggaaaccgcctcttgtgtaaaaaacagaggaagactgcgtacaatacaccaaaatggtaggaccccttcccgaaccctgcatatgcgggagctttagtg 21566555  T
Q  335 caccgg 340  Q
    ||||||    
T  21566556 caccgg 21566561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 305
Target Start/End: Complemental strand, 23419788 - 23419719
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcc 305  Q
    ||||||||||||||||| ||||||  |||||||| ||||||||||||||||||||| | ||||| |||||    
T  23419788 tggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcc 23419719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 256 - 336
Target Start/End: Complemental strand, 8149039 - 8148960
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||| |||||||||||||||||||| | ||||| |||||| || | | |||||| ||||| |||||||||    
T  8149039 aaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccaga-cttgcgtatgcgagagttttagtgca 8148960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 256 - 320
Target Start/End: Complemental strand, 14099100 - 14099036
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatg 320  Q
    ||||| ||| |||| ||||||||||||||||||||| | ||||| ||||||| ||||||||||||    
T  14099100 aaaaacaggttaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctacgtatg 14099036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 256 - 320
Target Start/End: Complemental strand, 14409117 - 14409053
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatg 320  Q
    ||||| ||| |||| ||||||||||||||||||||| | ||||| ||||||| ||||||||||||    
T  14409117 aaaaacaggttaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctacgtatg 14409053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 264 - 340
Target Start/End: Complemental strand, 28362231 - 28362156
Alignment:
Q  264 ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    |||||||||||||||||||||||||||| | ||||| |||||| |||| | | |||||| ||||||| |||||||||    
T  28362231 ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccagaccttgcatatgtgggagcttt-gtgcaccgg 28362156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 239 - 340
Target Start/End: Original strand, 16341301 - 16341404
Alignment:
Q  239 gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||| ||||||  ||||||||||| ||||||||||||| ||||| | || ||||||||||||||   | |||| | ||||||| |||||    
T  16341301 gaaacagcctcttgtgtaaaaaacagggtaaggctacgtacaatacaccaaaatggtgggccctcttcccggacctatcatatgcgggagctttggtgca 16341400  T
Q  337 ccgg 340  Q
    ||||    
T  16341401 ccgg 16341404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 312
Target Start/End: Original strand, 46354215 - 46354293
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccc 312  Q
    |||||||| |||||||| ||||||  ||||||||||||||||||||||||||  |||| | ||||| ||||||||||||    
T  46354215 tggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccc 46354293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 18326989 - 18327075
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| | || ||| |||||||| ||||| |||||||| |||||||||||    
T  18326989 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgacttgaaggtcacgggttcaagtcccggaaacagcctcttgtgtaa 18327075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 22699150 - 22699064
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||||||  | |||| | |||||||||||| |||||| || | ||||| ||||||| |||||||||| ||||||||||||||    
T  22699150 aggggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggttatgggttcaagtcctggaaatagtctcttgtgtaa 22699064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 32758216 - 32758302
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| || ||||| |||||||||||||| |||||||||||    
T  32758216 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaa 32758302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 272 - 353
Target Start/End: Complemental strand, 23066003 - 23065922
Alignment:
Q  272 tgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcctttttat 353  Q
    |||||||||||||||| ||||| ||| | ||| ||| | ||| | |||||| ||||||| ||||||||||||||| ||||||    
T  23066003 tgcgtacaatacaccatatgatgggatccctttccgaatcctgcatatgtgggagctttggtgcaccggattgcccttttat 23065922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 239 - 331
Target Start/End: Complemental strand, 28078243 - 28078151
Alignment:
Q  239 gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttta 331  Q
    ||||||| ||| |||| ||||| ||||||||| ||| | |||||||||||||| | ||||| ||||||| | ||| | |||| ||||||||||    
T  28078243 gaaacagtctcgtgtaaaaaaacagggtaaggttgcatgcaatacaccaaatggtgggaccccttcccgaatcctgcatatgcgagagcttta 28078151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 237 - 305
Target Start/End: Original strand, 42476894 - 42476961
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcc 305  Q
    ||||||||| ||||||| |||||  ||| |||||||||||||||||||||||||| | ||||| |||||    
T  42476894 tggaaacagtctcttgtgtaaaacaagg-taaggctgcgtacaatacaccaaatggtgggaccccttcc 42476961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Complemental strand, 1424067 - 1424004
Alignment:
Q  174 taaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||||||||||||| |||| ||| |||| ||| | ||||||||||||||| ||||||||    
T  1424067 taaagttgttgttatgtgactggaaggtcacggattcaaatcctggaaacagtctgttgtgtaa 1424004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 240 - 291
Target Start/End: Original strand, 6736914 - 6736965
Alignment:
Q  240 aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatg 291  Q
    ||||| ||||||||||||||| | |||||| |||| ||||||||||||||||    
T  6736914 aaacaacctcttgtataaaaacaaggtaagactgcatacaatacaccaaatg 6736965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Complemental strand, 10693228 - 10693165
Alignment:
Q  174 taaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| |||||| || | ||| ||||||||| ||||||||||||| |||||||||||    
T  10693228 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 10693165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 32233248 - 32233145
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||| |||||||| |||||| |||||||||| ||||| | ||||||||||| | |||   ||||||  ||||| | |||| | |||||| ||||||    
T  32233248 tggaaacaacctcttgtgtaaaaacagggtaaggcagcgtatattacaccaaatggtgggattccttcccaaaccctgcatatgagggagcttcagtgca 32233149  T
Q  337 ccgg 340  Q
    ||||    
T  32233148 ccgg 32233145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 21447545 - 21447631
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| |||||| ||||||| |||| |||||| ||| |||| ||| |||| || |||||| |||||||||||    
T  21447545 aggggtaaccttggcgcaactgataaatttgttgtcatgtaattggaaggtcacggattcaagtcttgaaaacagcctcttgtgtaa 21447631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 228
Target Start/End: Complemental strand, 35334994 - 35334916
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctc 228  Q
    |||| ||||||| || |||| | |||||||||||| |||||| |||| ||| ||| |||| ||||||||||||||||||    
T  35334994 agggataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgagttcaagtcctggaaacagtctc 35334916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 268 - 341
Target Start/End: Complemental strand, 36267900 - 36267826
Alignment:
Q  268 aggctgcgtacaatacaccaaatgatagga-cctcttcccggaccctacgtatgtgagagctttagtgcaccgga 341  Q
    |||||||||||||||||||||||| | ||| ||  |||||| |||||  ||||| | ||||||||||||||||||    
T  36267900 aggctgcgtacaatacaccaaatggttggacccatttcccgaaccctgtgtatgcgggagctttagtgcaccgga 36267826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 267 - 338
Target Start/End: Original strand, 39123945 - 39124018
Alignment:
Q  267 aaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||||||||| |||||||||||  || | ||||| ||||||||||||| |||||| | ||||||| |||||||    
T  39123945 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc 39124018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 232
Target Start/End: Complemental strand, 42496015 - 42495933
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgt 232  Q
    |||||||||||| || |||| | |||||||||||| || ||| || | ||| |||||||| |||||||||||||| |||||||    
T  42496015 aggggtaaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt 42495933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 43557427 - 43557513
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||||||  | |||| | |||||||||||| |||||| || | ||| | ||||||| ||||||||||||| |||||||||||    
T  43557427 aggggtaaccttgccgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaa 43557513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 282
Target Start/End: Original strand, 22065609 - 22065654
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaata 282  Q
    |||||||| |||||||| |||||||||||||| ||||| |||||||    
T  22065609 tggaaacaacctcttgtgtaaaaatagggtaaagctgcatacaata 22065654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 156 - 236
Target Start/End: Original strand, 40463837 - 40463918
Alignment:
Q  156 taaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    ||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||| | |||||||||||||||||||    
T  40463837 taaccttggcgcaaccggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatagaaacagtctcttgtgtaa 40463918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 270
Target Start/End: Complemental strand, 42495949 - 42495916
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaagg 270  Q
    |||||||||||||||||||||||| |||||||||    
T  42495949 tggaaacagcctcttgtataaaaacagggtaagg 42495916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 256 - 340
Target Start/End: Complemental strand, 22699064 - 22698977
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaa--tgataggacc-tcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    ||||| |||||||| |||||||||||||||||||  || | ||||| | ||||||||||||  ||||| | ||||| |||||||||||    
T  22699064 aaaaacagggtaagactgcgtacaatacaccaaaaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtgcaccgg 22698977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 352
Target Start/End: Complemental strand, 48746 - 48632
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| |||||||    
T  48746 tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 48648  T
Q  337 ccggattgccttttta 352  Q
    |||| ||||| |||||    
T  48647 ccgggttgccctttta 48632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 60; Significance: 2e-25; HSPs: 35)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 352
Target Start/End: Complemental strand, 1354869 - 1354755
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| |||||||    
T  1354869 tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 1354771  T
Q  337 ccggattgccttttta 352  Q
    |||| ||||| |||||    
T  1354770 ccgggttgccctttta 1354755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 26097181 - 26097294
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  |||||||||||||||||||||||||||||||  ||||| ||||||||||||| | |||| | ||||| |||||||    
T  26097181 tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatgaagggaccccttcccggaccctgcatatgcgggagctctagtgca 26097279  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||| ||||    
T  26097280 ccgggttgccctttt 26097294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 29355971 - 29355854
Alignment:
Q  237 tggaaacagcctcttgtataa-aaatagggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||| ||| ||| |||||||||||||||||||||||||||  ||| | ||||| ||||||||||||| |||||| | ||||||||||    
T  29355971 tggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagt 29355872  T
Q  334 gcaccggattgccttttt 351  Q
    ||||||| ||||| ||||    
T  29355871 gcaccgggttgccctttt 29355854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 1346985 - 1347098
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||| ||||| |||||  |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| |||||||    
T  1346985 tggaaacagccacttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 1347083  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||| ||||    
T  1347084 ccgggttgccctttt 1347098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 25557746 - 25557859
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  |||||||||||||||||||||||||||||||  | ||| ||||||||||||| | |||| | ||||| |||||||    
T  25557746 tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatgaaggaaccccttcccggaccctgcatatgcgggagctctagtgca 25557844  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||| ||||    
T  25557845 ccgggttgccctttt 25557859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 12222031 - 12221913
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagc-tttag 332  Q
    ||||||||||||||||| ||||||  ||||||||||||||||||||||||||  |||| | ||||| ||||||||||||| |||||| | |||| |||||    
T  12222031 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagcttttag 12221932  T
Q  333 tgcaccggattgccttttt 351  Q
    |||||||| ||||| ||||    
T  12221931 tgcaccgggttgccctttt 12221913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 333
Target Start/End: Original strand, 32579447 - 32579543
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    |||||||||||||| ||||||||||| |||||| ||||||||||||| ||||||| | ||||| |||||| |||||| | |||| | ||||||||||    
T  32579447 tggaaacagcctctggtataaaaatacggtaagcctgcgtacaataccccaaatggtgggaccccttcccagaccctgcatatgcgggagctttagt 32579543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 9161144 - 9161260
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    ||||||||||||||||| |||||| || |||||||||||||||||||| ||  |||| | ||||| |||| |||||||| |||||| |  ||||||||||    
T  9161144 tggaaacagcctcttgtgtaaaaacagagtaaggctgcgtacaatacatcaataatggtgggaccccttctcggaccctgcgtatgcggaagctttagtg 9161243  T
Q  335 caccggattgccttttt 351  Q
    |||| | ||||| ||||    
T  9161244 caccaggttgccctttt 9161260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 7947486 - 7947384
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    |||||||| |||| ||| ||||||  ||||||||||||||||||||||||| ||||| | || || ||||||||||| | |||||||| |||||||||||    
T  7947486 tggaaacaacctcctgtgtaaaaaccagggtaaggctgcgtacaatacaccaaaatggtgggcccccttcccggaccttgcgtatgtgggagctttagtg 7947387  T
Q  335 cac 337  Q
    |||    
T  7947386 cac 7947384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 256 - 340
Target Start/End: Complemental strand, 3815171 - 3815087
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg 340  Q
    ||||||| |||| | ||||||||||||||||||||| | |||||  |||||| |||||||||||| |  ||||||||||||||||    
T  3815171 aaaaatatggtacgactgcgtacaatacaccaaatggtgggaccctttcccgaaccctacgtatgcggaagctttagtgcaccgg 3815087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 18277307 - 18277203
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    ||||||||||||||||| ||||||| ||||||||| || |||||  |||||||||| | ||||| |||||  ||| ||||||||| | |||||||| |||    
T  18277307 tggaaacagcctcttgtgtaaaaatcagggtaaggttgagtacagaacaccaaatggtgggaccccttcctagactctacgtatgcgggagctttactgc 18277208  T
Q  336 accgg 340  Q
    |||||    
T  18277207 accgg 18277203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 2166526 - 2166409
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    |||||||| |||||||| ||||| | ||| ||||| |||||||||||||||||  ||| | ||||| ||||||||||||||  |||  | ||||||||||    
T  2166526 tggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagt 2166427  T
Q  334 gcaccggattgccttttt 351  Q
    ||||||| ||||| ||||    
T  2166426 gcaccgggttgccctttt 2166409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 2178159 - 2178042
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    |||||||| |||||||| ||||| | ||| ||||| |||||||||||||||||  ||| | ||||| ||||||||||||||  |||  | ||||||||||    
T  2178159 tggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagt 2178060  T
Q  334 gcaccggattgccttttt 351  Q
    ||||||| ||||| ||||    
T  2178059 gcaccgggttgccctttt 2178042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 239 - 312
Target Start/End: Original strand, 6024256 - 6024332
Alignment:
Q  239 gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccc 312  Q
    ||||||||||||||| ||||||  | |||||| |||||||||||||||||  |||||| ||||||||||||||||||    
T  6024256 gaaacagcctcttgtgtaaaaaacatggtaagactgcgtacaatacaccaataatgatgggacctcttcccggaccc 6024332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 352
Target Start/End: Original strand, 12885967 - 12886050
Alignment:
Q  271 ctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttta 352  Q
    ||||||||||||||| |||  || | ||||| |||||| |||||| |||||||| ||||||||||||||||| ||||| |||||    
T  12885967 ctgcgtacaatacacaaaaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgccctttta 12886050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 339
Target Start/End: Original strand, 33138854 - 33138957
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||||| |||||||||||||||  || ||||||| ||||||||||||||||||| | |||||  || |||||||||  |||||    |||||||||||    
T  33138854 tggaaacaacctcttgtataaaaaacagagtaaggccgcgtacaatacaccaaatggtgggacccttttccggaccctgtgtatgcagtagctttagtgc 33138953  T
Q  336 accg 339  Q
    ||||    
T  33138954 accg 33138957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 1346919 - 1347005
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| | |||||||||    
T  1346919 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagccacttgtgtaa 1347005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 240 - 336
Target Start/End: Original strand, 12889450 - 12889548
Alignment:
Q  240 aaacagcctcttgtat-aaaaatagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    |||||||||||||| | ||||| |||| |||||||| ||||||||||| ||| ||| ||||| ||| |||||||||  || |||| |||||||||||||    
T  12889450 aaacagcctcttgtgttaaaaacagggcaaggctgcatacaatacacctaaacgatgggacccctttccggaccctctgtgtgtgggagctttagtgca 12889548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 14975260 - 14975174
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    |||| ||||||| || |||| | |||||||||||| |||||| |||| ||| |||| |||| ||||||||||||| |||||||||||    
T  14975260 agggataaccttggcgcaaccggtaaagttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcctcttgtgtaa 14975174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 278 - 351
Target Start/End: Original strand, 13267788 - 13267861
Alignment:
Q  278 caatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    |||||||||||||| | ||||| ||||| ||||||| |||||| | |||||| |||||||||| ||||| ||||    
T  13267788 caatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgccctttt 13267861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 272 - 353
Target Start/End: Complemental strand, 23930205 - 23930124
Alignment:
Q  272 tgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcctttttat 353  Q
    |||||||||||||||| ||| | ||||| |||| |||||||| | |||| | ||||||||||||||||  ||||| ||||||    
T  23930205 tgcgtacaatacaccagatggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgcccttttat 23930124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 306
Target Start/End: Original strand, 28007649 - 28007717
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttccc 306  Q
    |||||| |||||||||| |||||  ||||| |||||||||||||||||||||||| | ||||| ||||||    
T  28007649 tggaaagagcctcttgtgtaaaac-agggtcaggctgcgtacaatacaccaaatgctgggaccccttccc 28007717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Complemental strand, 2166569 - 2166506
Alignment:
Q  174 taaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||||||||||||| || | ||| |||||||| |||||||||||||  |||||||||||    
T  2166569 taaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaa 2166506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Complemental strand, 2178202 - 2178139
Alignment:
Q  174 taaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||||||||||||| || | ||| |||||||| |||||||||||||  |||||||||||    
T  2178202 taaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaa 2178139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 243 - 334
Target Start/End: Original strand, 24097608 - 24097696
Alignment:
Q  243 cagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg 334  Q
    ||||||||||||||||||  ||||||||||||| |||||    ||||||| | ||||| ||||||||||||| |||||| |  ||||||||||    
T  24097608 cagcctcttgtataaaaaacagggtaaggctgcttacaa----ccaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtg 24097696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 8409198 - 8409284
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| |||| ||| |||||||||||| | |||||||||||    
T  8409198 aggggtaaccttggcgcaactggtaaagttgttgtaatgtgactgaaaggtcacggattcaagtcctggaaactgcctcttgtgtaa 8409284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 256 - 289
Target Start/End: Complemental strand, 2755518 - 2755485
Alignment:
Q  256 aaaaatagggtaaggctgcgtacaatacaccaaa 289  Q
    ||||||||| ||||||||||||||||||||||||    
T  2755518 aaaaataggctaaggctgcgtacaatacaccaaa 2755485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 152 - 236
Target Start/End: Complemental strand, 3815256 - 3815171
Alignment:
Q  152 ggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||||| || |||| | |||||||||||| |||||| || |  || |||||||| |||||||||||||| || ||||||||    
T  3815256 ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcctggaaacagactattgtgtaa 3815171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 287 - 343
Target Start/End: Complemental strand, 16916050 - 16915993
Alignment:
Q  287 aaatgataggacctc-ttcccggaccctacgtatgtgagagctttagtgcaccggatt 343  Q
    ||||| ||||||||| ||||  |||||||| |||||| ||||||||||||||||||||    
T  16916050 aaatggtaggacctccttcctagaccctacatatgtgggagctttagtgcaccggatt 16915993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 240 - 291
Target Start/End: Original strand, 1941879 - 1941931
Alignment:
Q  240 aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatg 291  Q
    ||||| |||||||| ||||||  ||||||||||||||||||||||||| ||||    
T  1941879 aaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccgaatg 1941931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 295 - 351
Target Start/End: Original strand, 6808475 - 6808531
Alignment:
Q  295 ggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    ||||| |||||||||||||  ||||| | ||||||||||||||||| ||||| ||||    
T  6808475 ggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccctttt 6808531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 313
Target Start/End: Complemental strand, 15865970 - 15865894
Alignment:
Q  237 tggaaacagcctctt--gtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct 313  Q
    |||||||||||||||  ||| ||||| ||||||| ||||||||  |||||||||||| | ||||| ||||| |||||||    
T  15865970 tggaaacagcctcttacgtaaaaaaacagggtaaagctgcgta--atacaccaaatggtgggaccccttcctggaccct 15865894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 313
Target Start/End: Complemental strand, 15866151 - 15866076
Alignment:
Q  237 tggaaacagcctctt--gtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct 313  Q
    |||||||||||||||  ||| ||||| ||||||| ||||||||  |||||||||||| | ||||| |||||||||||||    
T  15866151 tggaaacagcctcttaagta-aaaaacagggtaaagctgcgta--atacaccaaatggtgggaccccttcccggaccct 15866076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 23240936 - 23240837
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  ||||||||  ||||||||||| ||||| || | ||||| ||||  ||||  | |||||| | |||||||||||||    
T  23240936 tggaaacagcctcttgtgtaaaac-agggtaagtttgcgtacaatataccaattggtgggaccccttctaggacaatgcgtatgcgggagctttagtgca 23240838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 251 - 287
Target Start/End: Complemental strand, 27855536 - 27855500
Alignment:
Q  251 tgtataaaaatagggtaaggctgcgtacaatacacca 287  Q
    |||| |||||||||||||||||||||| |||||||||    
T  27855536 tgtaaaaaaatagggtaaggctgcgtataatacacca 27855500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0258 (Bit Score: 55; Significance: 2e-22; HSPs: 2)
Name: scaffold0258
Description:

Target: scaffold0258; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 13137 - 13023
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||  |||||| | ||||||||||||||||||||||| |||| | ||||| |||||| |||||| |||||| | | |||||||||||    
T  13137 tggaaacagcctcttgcgtaaaaacaaggtaaggctgcgtacaatacaccgaatggtgggaccccttcccagaccctgcgtatgcgggggctttagtgca 13038  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||| ||||    
T  13037 ccgggttgccctttt 13023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0258; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 152 - 236
Target Start/End: Complemental strand, 13202 - 13117
Alignment:
Q  152 ggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||||| || |||| | |||||||||||| |||||| || | ||| || ||||| |||||||||||||| |||||| ||||    
T  13202 ggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgcgtaa 13117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0168 (Bit Score: 55; Significance: 2e-22; HSPs: 2)
Name: scaffold0168
Description:

Target: scaffold0168; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 30600 - 30713
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  |||||| ||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| |||||||    
T  30600 tggaaacagcctcttgtgtaaaac-agggtagggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 30698  T
Q  337 ccggattgccttttt 351  Q
    |||| ||||| ||||    
T  30699 ccgggttgccctttt 30713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0168; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 30534 - 30620
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    |||||||||||| || |||| | |||||||||||| |||||| || | ||| || ||||| |||||||||||||| |||||||||||    
T  30534 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgtgtaa 30620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0180 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: scaffold0180
Description:

Target: scaffold0180; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 263 - 351
Target Start/End: Complemental strand, 24220 - 24132
Alignment:
Q  263 gggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt 351  Q
    ||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||||||||||||| ||||    
T  24220 gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccctttt 24132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1176 (Bit Score: 51; Significance: 5e-20; HSPs: 1)
Name: scaffold1176
Description:

Target: scaffold1176; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 240 - 350
Target Start/End: Complemental strand, 1696 - 1587
Alignment:
Q  240 aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg 339  Q
    ||||| |||||||| |||||  ||| ||||||||| |||||||||||||||||| ||||| ||||||||||||  |||||| | |||||||||||||||     
T  1696 aaacaacctcttgtgtaaaac-aggataaggctgcatacaatacaccaaatgatgggaccccttcccggacccggcgtatgcgggagctttagtgcacca 1598  T
Q  340 gattgcctttt 350  Q
    | |||||||||    
T  1597 ggttgcctttt 1587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0954 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: scaffold0954
Description:

Target: scaffold0954; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 237 - 339
Target Start/End: Original strand, 3565 - 3668
Alignment:
Q  237 tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc 335  Q
    |||||| |||||||||| ||||| ||| |||||||||||||| |||||||| |||||| ||||| ||||||| ||||| |||||| |  |||||||||||    
T  3565 tggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgc 3664  T
Q  336 accg 339  Q
    ||||    
T  3665 accg 3668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0311 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0311
Description:

Target: scaffold0311; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 240 - 337
Target Start/End: Original strand, 10834 - 10932
Alignment:
Q  240 aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac 337  Q
    ||||| |||||||| ||||||  |||||| |||||||| |||||||||||||| | ||||| ||||||||||||| |||||| | ||||||||||||||    
T  10834 aaacaacctcttgtgtaaaaaacagggtagggctgcgtccaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac 10932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0049 (Bit Score: 46; Significance: 5e-17; HSPs: 1)
Name: scaffold0049
Description:

Target: scaffold0049; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 58998 - 59110
Alignment:
Q  237 tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacc--aaatgataggacctcttcccggaccctacgtatgtgagagctttagt 333  Q
    ||||||||||||||||||||||||  |||||||| ||||||||||||||||  ||||| | ||||| |||||| ||| || |||||| | ||||||||||    
T  58998 tggaaacagcctcttgtataaaaaacagggtaagactgcgtacaatacaccaaaaatggtgggaccccttcccagactctgcgtatgcgggagctttagt 59097  T
Q  334 gcaccggattgcc 346  Q
    ||| ||| |||||    
T  59098 gcatcgggttgcc 59110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 264 - 338
Target Start/End: Complemental strand, 72953 - 72879
Alignment:
Q  264 ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc 338  Q
    ||||||||||| |||||||||||||||| ||| ||| ||||||||| ||| |||||| | |||||||||||||||    
T  72953 ggtaaggctgcctacaatacaccaaatggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcacc 72879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 338
Target Start/End: Original strand, 11152 - 11252
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  | | ||||||||| |||||||||||||||| | ||||  ||||||||||||| | |||| | ||||| |||||||    
T  11152 tggaaacagcctcttgtgtaaaacaaag-taaggctgcttacaatacaccaaatggtgggacaccttcccggaccctgcatatgcgggagctctagtgca 11250  T
Q  337 cc 338  Q
    ||    
T  11251 cc 11252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187 (Bit Score: 38; Significance: 0.000000000003; HSPs: 4)
Name: scaffold0187
Description:

Target: scaffold0187; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 10162 - 10054
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  || ||||| ||||||||||||||||||||  | ||||| ||||||||||||| | ||||   |||||  ||||||    
T  10162 tggaaacagcctcttgtgtaaaac-agagtaagactgcgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgca 10064  T
Q  337 ccggattgcc 346  Q
    |||| |||||    
T  10063 ccgggttgcc 10054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 20490 - 20382
Alignment:
Q  237 tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca 336  Q
    ||||||||||||||||| |||||  || ||||| ||||||||||||||||||||  | ||||| ||||||||||||| | ||||   |||||  ||||||    
T  20490 tggaaacagcctcttgtgtaaaac-agagtaagactgcgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgca 20392  T
Q  337 ccggattgcc 346  Q
    |||| |||||    
T  20391 ccgggttgcc 20382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 153 - 236
Target Start/End: Complemental strand, 10226 - 10142
Alignment:
Q  153 gggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||||  | |||| | |||||||||||| |||||| || | ||| ||||||||| ||||||||||||| |||||||||||    
T  10226 gggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 10142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 153 - 236
Target Start/End: Complemental strand, 20554 - 20470
Alignment:
Q  153 gggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||||  | |||| | |||||||||||| |||||| || | ||| ||||||||| ||||||||||||| |||||||||||    
T  20554 gggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa 20470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0254 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0254
Description:

Target: scaffold0254; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Original strand, 4135 - 4198
Alignment:
Q  174 taaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa 236  Q
    ||||||||||||||||||| || | ||| |||||||| |||||||||||||  |||||||||||    
T  4135 taaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaa 4198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0194 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0194
Description:

Target: scaffold0194; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 224
Target Start/End: Original strand, 24619 - 24693
Alignment:
Q  151 aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacag 224  Q
    |||||||||||| ||||||  |||||||||||||| | |||| || | ||| |||||||| ||||||||||||||    
T  24619 aggggtaaccttggcacaattgataaagttgttgtcaagtgactgtaaggtcacgggttcaagtcctggaaacag 24693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 257 - 291
Target Start/End: Complemental strand, 35110 - 35076
Alignment:
Q  257 aaaatagggtaaggctgcgtacaatacaccaaatg 291  Q
    |||| ||||||||||||||||||||||||||||||    
T  35110 aaaacagggtaaggctgcgtacaatacaccaaatg 35076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 239 - 300
Target Start/End: Complemental strand, 226518 - 226455
Alignment:
Q  239 gaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacaccaaatgataggacct 300  Q
    ||||||||||||||| |||||| |  |||||||||||| ||||||||| |||||| | ||||||    
T  226518 gaaacagcctcttgtctaaaaaaacagggtaaggctgcatacaatacatcaaatggtgggacct 226455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University