View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9523_low_11 (Length: 341)
Name: NF9523_low_11
Description: NF9523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9523_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 6e-96; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 16 - 201
Target Start/End: Original strand, 222520 - 222705
Alignment:
| Q |
16 |
cacgcagttcctgactggaaggaacggtgaaaccatcgacaaaaattgaaactccggcgaatatagggttcacacaagaagtggaagcttcttcggtgtt |
115 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
222520 |
cacgcagttcctgactggatggaacggtgaaaccatcgacaaaaattgaaactccggcgaatatagggttcccacaagaagtggaagcttcttcggtgtt |
222619 |
T |
 |
| Q |
116 |
aaactgattgtgtagttttcgattcttctcagtcatgtaactgtaatagtgacatttttcaattaaatactgagaaattgagaagg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
222620 |
aaactgattgtgtagttttcgattcttctcagtcatgtaactgtaatagtgacatttttcaattaaatactgagaaattgagaagg |
222705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 233 - 337
Target Start/End: Original strand, 222732 - 222836
Alignment:
| Q |
233 |
acctggcaacatccgagaaaggggatttcgtggaattagaagagttcttcccccaggcaacgcctaaggttttctggttggtggtggtagttgttctctg |
332 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
222732 |
acctggcaacatcggagaaaggggattttgtggaattagaagagttcttcccccaggcgacgcctaaggttttctggttggtggtggtagttgttttctg |
222831 |
T |
 |
| Q |
333 |
ctgct |
337 |
Q |
| |
|
||||| |
|
|
| T |
222832 |
ctgct |
222836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University