View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9523_low_4 (Length: 501)
Name: NF9523_low_4
Description: NF9523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9523_low_4 |
 |  |
|
| [»] scaffold0057 (3 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0258 (2 HSPs) |
 |  |  |
|
| [»] scaffold0168 (2 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0954 (1 HSPs) |
 |  |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (4 HSPs) |
 |  |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 81)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 320
Target Start/End: Original strand, 21723512 - 21723811
Alignment:
| Q |
20 |
tcagaggcctcaaaaaggatttggtagaacctaaattaaaatttattcttagtggtagcagttattgctgtaatagtagtgtttatcttttcttttccnn |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21723512 |
tcagaggcctcaaaaaggatttggtagaacctaaattaaaatttattcttagtggtagcagttattgctgtaatagtagtgtttatcttttcttttcctt |
21723611 |
T |
 |
| Q |
120 |
nnnnnnaatagttatatgatgtcacaggataaggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttcagtcctgga |
219 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||| | |||||||||||| |||||| ||||||||||| ||||||||||||| |
|
|
| T |
21723612 |
ttttttaatagttatatgatgtcacaggaca-ggggtaaccttcgcacaactggtaaagttgttgtcatgtgactggatggttacaagttcagtcctgga |
21723710 |
T |
 |
| Q |
220 |
aacagtctcttgtgtaatggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtat |
319 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||| |||||||||||| ||||| |
|
|
| T |
21723711 |
aacagcctcttgtgtaatggaaacagcctcttgtataaaaatagggtaaggctgagtacaatacaccaaatggtagaaccttttcccggaccctgcgtat |
21723810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 365 - 490
Target Start/End: Original strand, 21723811 - 21723936
Alignment:
| Q |
365 |
ggacaaaacttttcaacccttcaaataattttataccacaaagattctgtgatgtttcaaaatcaagagatatatatttaattttctcctatgagtactg |
464 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21723811 |
ggacaaaacttttcaacccttcaaataattttataccacaaagattctgtgatgtttcaaaatcaagatatatatatttaattttctcctatgagtactg |
21723910 |
T |
 |
| Q |
465 |
acttatgttatttatctactagtata |
490 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
21723911 |
acttatgttatttatctactagtata |
21723936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 239 - 355
Target Start/End: Complemental strand, 35253297 - 35253181
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||||| |
|
|
| T |
35253297 |
gaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
35253199 |
T |
 |
| Q |
339 |
ggattg-cctttttatat |
355 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
35253198 |
ggattgccctttttatat |
35253181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 237 - 353
Target Start/End: Original strand, 27474325 - 27474441
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||| ||||||| |||||| |||| || |||||||||||||||| |||| | ||||| ||||||||||||| |||||| | ||||||||||||| |
|
|
| T |
27474325 |
tggaaacagtctcttgtgtaaaaacagggcaaagctgcgtacaatacactgaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca |
27474424 |
T |
 |
| Q |
337 |
ccggattgcctttttat |
353 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
27474425 |
ccggattgcccttttat |
27474441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 46248067 - 46247952
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||||||||||||||||||||| | ||||| ||||||||||||| |||||| | ||||||||||| |
|
|
| T |
46248067 |
tggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgt |
46247968 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
||||| ||||| |||| |
|
|
| T |
46247967 |
accgggttgccctttt |
46247952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 256 - 346
Target Start/End: Original strand, 4349702 - 4349792
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc |
346 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | ||||||||||||||||| ||||| |
|
|
| T |
4349702 |
aaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
4349792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 236 - 345
Target Start/End: Complemental strand, 23768435 - 23768325
Alignment:
| Q |
236 |
atggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | |||| |||||| |||||| |||||| | ||||||||||| |
|
|
| T |
23768435 |
atggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggacaccttcccagaccctgcgtatgcgggagctttagtg |
23768336 |
T |
 |
| Q |
335 |
caccggattgc |
345 |
Q |
| |
|
|| |||||||| |
|
|
| T |
23768335 |
cagcggattgc |
23768325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 46991848 - 46991958
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||| |||||||| |||||| |||||||||||| |||||||||||| |||| | ||||| ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
46991848 |
tggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgc |
46991947 |
T |
 |
| Q |
336 |
accggattgcc |
346 |
Q |
| |
|
||||| ||||| |
|
|
| T |
46991948 |
accgggttgcc |
46991958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 237 - 354
Target Start/End: Complemental strand, 34725210 - 34725094
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||| ||||| | ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
34725210 |
tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacactaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
34725112 |
T |
 |
| Q |
337 |
ccggattgcctttttata |
354 |
Q |
| |
|
|||| ||||| ||||||| |
|
|
| T |
34725111 |
ccgggttgcccttttata |
34725094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 6925144 - 6925259
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||| |||||||||| ||||| |||||||||||||||| |||||||||| |||| | ||||| |||||||| |||| |||||| | |||||||||||| |
|
|
| T |
6925144 |
tggaaatagcctcttgtgtaaaaaatagggtaaggctgcggacaatacaccgaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgc |
6925243 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
6925244 |
accgagttgccttttt |
6925259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 31382327 - 31382213
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| |||||| ||| |||||||||||||||||||||||||| | ||||| ||||| ||||||| | |||| | |||||||| || | |
|
|
| T |
31382327 |
tggaaacagcctcttgtgtaaaaacaggataaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcatatgcgggagctttactgta |
31382228 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
31382227 |
ccgggttgccctttt |
31382213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 237 - 338
Target Start/End: Complemental strand, 32632670 - 32632569
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| |||||| ||||| | |||| | |||||| |||||| |
|
|
| T |
32632670 |
tggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgca |
32632571 |
T |
 |
| Q |
337 |
cc |
338 |
Q |
| |
|
|| |
|
|
| T |
32632570 |
cc |
32632569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 18944687 - 18944805
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagc-tttag |
332 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||| |||| | ||||| ||||||||||||| |||||| | |||| ||||| |
|
|
| T |
18944687 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaacaatggtgggaccccttcccggaccctgcgtatgcgggagcttttag |
18944786 |
T |
 |
| Q |
333 |
tgcaccggattgccttttt |
351 |
Q |
| |
|
|||||||| ||||| |||| |
|
|
| T |
18944787 |
tgcaccgggttgccctttt |
18944805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 256 - 351
Target Start/End: Complemental strand, 42304303 - 42304206
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
||||| ||||||||| |||||||||||||| ||| || | ||||| ||||||||||||| |||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
42304303 |
aaaaacagggtaaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgccctttt |
42304206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 45402138 - 45402250
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggt--aagg-ctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| |||||| ||||| ||| ||||||||||||||||||||| | ||||| |||||| |||||| |||||| | |||||||||| |
|
|
| T |
45402138 |
tggaaacagcctcttgtgtaaaaacagggttcaagttctgcgtacaatacaccaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagt |
45402237 |
T |
 |
| Q |
334 |
gcaccggattgcc |
346 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
45402238 |
gcaccgggttgcc |
45402250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 353
Target Start/End: Original strand, 10668269 - 10668388
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| |||||| | ||||||| ||||||||||||||||| ||| | ||||| |||||||| |||| |||||| | |||||||||| |
|
|
| T |
10668269 |
tggaaacagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggtccctgcgtatgcgggagctttagt |
10668368 |
T |
 |
| Q |
334 |
gcaccggattgcctttttat |
353 |
Q |
| |
|
||||||| ||||| |||||| |
|
|
| T |
10668369 |
gcaccgggttgcccttttat |
10668388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 14617082 - 14617186
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaa-aatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||||| |||| || | ||||||| |||||||||||||||||||| | ||| | ||||||||||||| | |||| | |||||||||||| |
|
|
| T |
14617082 |
tggaaacagcctcttgtgtaaataacaaggtaaggttgcgtacaatacaccaaatggtgggatcccttcccggaccctgcatatgcgggagctttagtgc |
14617181 |
T |
 |
| Q |
336 |
accgg |
340 |
Q |
| |
|
||||| |
|
|
| T |
14617182 |
accgg |
14617186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 238 - 340
Target Start/End: Complemental strand, 18742073 - 18741967
Alignment:
| Q |
238 |
ggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
|||||||| || ||||||||||| | ||||||||||||||||||||||||||| || | ||||| |||||| |||||| |||||| |||||||||||| |
|
|
| T |
18742073 |
ggaaacagtcttttgtataaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagt |
18741974 |
T |
 |
| Q |
334 |
gcaccgg |
340 |
Q |
| |
|
||||||| |
|
|
| T |
18741973 |
gcaccgg |
18741967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 320
Target Start/End: Complemental strand, 25468377 - 25468293
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatg |
320 |
Q |
| |
|
|||||||| |||||||| ||||||| ||||||||| |||||||||||||||||||| | |||||||||||| |||||| |||||| |
|
|
| T |
25468377 |
tggaaacaacctcttgtgtaaaaatcagggtaaggttgcgtacaatacaccaaatggttggacctcttcccagaccctgcgtatg |
25468293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 353
Target Start/End: Complemental strand, 30395842 - 30395723
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||| |||| | ||||| |||||||||||| | |||| | |||||||||| |
|
|
| T |
30395842 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagt |
30395743 |
T |
 |
| Q |
334 |
gcaccggattgcctttttat |
353 |
Q |
| |
|
|||||| ||||| |||||| |
|
|
| T |
30395742 |
gcaccgagttgcccttttat |
30395723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 240 - 352
Target Start/End: Original strand, 35005170 - 35005285
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||| |||||||||||||| || | ||||| ||||||||||||| |||||| | | ||||||||||| |
|
|
| T |
35005170 |
aaacagcctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggcgctttagtgca |
35005269 |
T |
 |
| Q |
337 |
ccggattgccttttta |
352 |
Q |
| |
|
|||| ||||| ||||| |
|
|
| T |
35005270 |
ccgggttgccctttta |
35005285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 239 - 351
Target Start/End: Complemental strand, 38478392 - 38478281
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||| | | ||| |||| |||||||| | |||| | ||||| ||||||||| |
|
|
| T |
38478392 |
gaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtggaaccccttctcggaccctgcatatgcgggagctctagtgcacc |
38478294 |
T |
 |
| Q |
339 |
ggattgccttttt |
351 |
Q |
| |
|
|| ||||| |||| |
|
|
| T |
38478293 |
gggttgccctttt |
38478281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 352
Target Start/End: Complemental strand, 41319920 - 41319804
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||| ||||| ||||||| ||||| | |||| | ||| || ||||| |
|
|
| T |
41319920 |
tggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatgatgggaccccttcccgaacccttcatatgcgggagtttcagtgc |
41319821 |
T |
 |
| Q |
336 |
accggattgccttttta |
352 |
Q |
| |
|
|| || ||||| ||||| |
|
|
| T |
41319820 |
actgggttgccctttta |
41319804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 239 - 330
Target Start/End: Original strand, 11596559 - 11596650
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttt |
330 |
Q |
| |
|
|||||| |||||||| |||||| |||||||||||||||| ||||||||||||| | ||||| ||||| ||||||| |||||| | ||||||| |
|
|
| T |
11596559 |
gaaacaacctcttgtgtaaaaacagggtaaggctgcgtataatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttt |
11596650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 237 - 330
Target Start/End: Complemental strand, 18724659 - 18724565
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttt |
330 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||| |||||||||||||||| | ||||| ||||||||||||||| |||| | ||||||| |
|
|
| T |
18724659 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaaatcttgggaccccttcccggaccctacatatgcgggagcttt |
18724565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 19974188 - 19974087
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||| || ||||||||||| |||| ||||||||||||||| ||||||| ||||| ||||||||| ||| ||||| | |||||||||||| |
|
|
| T |
19974188 |
tggaaacagcctcaagtgtaaaaatagggcaaggttgcgtacaatacaccaaaatgatgggacccattcccggactctatgtatgcgggagctttagtgc |
19974089 |
T |
 |
| Q |
336 |
ac |
337 |
Q |
| |
|
|| |
|
|
| T |
19974088 |
ac |
19974087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 12126949 - 12126850
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||||| |||||| ||||| ||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
12126949 |
tggaaacagcttcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaattgtgggaccccttcccggaccctgcatatgcgggagctgtagtgca |
12126851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 245 - 317
Target Start/End: Complemental strand, 21910754 - 21910682
Alignment:
| Q |
245 |
gcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgt |
317 |
Q |
| |
|
||||||| | |||||||||||||||| |||||||||||||||||||| | ||||| ||||||| ||||||||| |
|
|
| T |
21910754 |
gcctcttatgtaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctacgt |
21910682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 264 - 340
Target Start/End: Complemental strand, 44485195 - 44485120
Alignment:
| Q |
264 |
ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||| ||||||||| |||||||||| | ||||||| ||||||||| |
|
|
| T |
44485195 |
ggtaaggctgcgtacaatacaccaaatggttggaccccttcccggatcctacgtatgcgggagcttt-gtgcaccgg |
44485120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 264 - 351
Target Start/End: Original strand, 8197115 - 8197202
Alignment:
| Q |
264 |
ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
||||||||| |||||| ||||||||||| ||||||| |||| |||||||| ||||||| ||||||||||| ||||| ||||| |||| |
|
|
| T |
8197115 |
ggtaaggctacgtacagtacaccaaatggtaggaccccttctcggaccctgcgtatgttggagctttagtgtaccgggttgccctttt |
8197202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 257 - 340
Target Start/End: Complemental strand, 10378828 - 10378745
Alignment:
| Q |
257 |
aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| | ||||| |||| ||||||| | |||| | ||||||||||||||||| |
|
|
| T |
10378828 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgg |
10378745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 257 - 352
Target Start/End: Original strand, 19414502 - 19414597
Alignment:
| Q |
257 |
aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttta |
352 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||| | ||||| ||||||| ||||| | |||| | ||||| ||||||||||| ||||| ||||| |
|
|
| T |
19414502 |
aaaacaggttaaggctgcgtacaatacaccaaatggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
19414597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 336
Target Start/End: Original strand, 27201691 - 27201793
Alignment:
| Q |
237 |
tggaaacagcctcttgtataa-aaatagggtaaggctgcgtacaatacacc--aaatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| | | ||| ||||||||||||||||||||||||| ||||| | ||||| ||||||||||| | |||||| | |||||||||| |
|
|
| T |
27201691 |
tggaaacagcctcttgtgtcagaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccttgcgtatgcgggagctttagt |
27201790 |
T |
 |
| Q |
334 |
gca |
336 |
Q |
| |
|
||| |
|
|
| T |
27201791 |
gca |
27201793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 240 - 351
Target Start/End: Complemental strand, 45812646 - 45812536
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg |
339 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||||||| |||||||||||||||| | ||||| |||||| ||||| | |||| | ||||| |||||||||| |
|
|
| T |
45812646 |
aaacagtctcttgtgtaaaag-agggtaaggctgcatacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccg |
45812548 |
T |
 |
| Q |
340 |
gattgccttttt |
351 |
Q |
| |
|
| |||||||||| |
|
|
| T |
45812547 |
ggttgccttttt |
45812536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 237 - 341
Target Start/End: Complemental strand, 2435901 - 2435795
Alignment:
| Q |
237 |
tggaaacagcctcttgtat-aaaaatagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
||||||||||||| ||| | |||||||||||||| |||||||||||||||| ||||| | ||||| ||| ||| ||||| || ||| | ||||||||||| |
|
|
| T |
2435901 |
tggaaacagcctcctgtgtgaaaaatagggtaagcctgcgtacaatacaccaaaatggtgggacccctttccgtaccctccgcatgcgggagctttagtg |
2435802 |
T |
 |
| Q |
335 |
caccgga |
341 |
Q |
| |
|
||||||| |
|
|
| T |
2435801 |
caccgga |
2435795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 237 - 343
Target Start/End: Original strand, 47214555 - 47214660
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||| ||||||| ||||| ||||||||| |||||||||||||||||||| | ||||| |||||| |||||| | |||| | ||||| ||||||| |
|
|
| T |
47214555 |
tggaaacagtctcttgtttaaaac-agggtaaggttgcgtacaatacaccaaatggtgggaccccttcccagaccctgcatatgcgggagctctagtgca |
47214653 |
T |
 |
| Q |
337 |
ccggatt |
343 |
Q |
| |
|
|| |||| |
|
|
| T |
47214654 |
ccagatt |
47214660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 262 - 351
Target Start/End: Original strand, 15505634 - 15505722
Alignment:
| Q |
262 |
agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
|||||||| ||||||||||||||||||||| | ||||| ||||||| ||||| |||||| | ||||||| |||||||| | ||||||||| |
|
|
| T |
15505634 |
agggtaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagcttt-gtgcaccgaactgccttttt |
15505722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 240 - 340
Target Start/End: Original strand, 35019277 - 35019377
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||| |||||||||||||||| || ||||||||| ||||||||||||| || | ||||| || ||| |||||| |||||| ||||||||||||||||| |
|
|
| T |
35019277 |
aaacaacctcttgtataaaaatcagtataaggctgcatacaatacaccaattggtgggacccct-cccagaccctgcgtatgcgagagctttagtgcacc |
35019375 |
T |
 |
| Q |
339 |
gg |
340 |
Q |
| |
|
|| |
|
|
| T |
35019376 |
gg |
35019377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 15511265 - 15511158
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcg--tacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttag |
332 |
Q |
| |
|
||||||| ||||||||| |||||| |||||||||||||| |||||||||||||| || | | ||| ||||| ||||||| |||||||| ||||||||| |
|
|
| T |
15511265 |
tggaaaccgcctcttgtgtaaaaaacagggtaaggctgcggatacaatacaccaaaatggtggtaccccttcctggaccctgcgtatgtgtgagctttag |
15511166 |
T |
 |
| Q |
333 |
tgcaccgg |
340 |
Q |
| |
|
|||||||| |
|
|
| T |
15511165 |
tgcaccgg |
15511158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 353
Target Start/End: Complemental strand, 20004206 - 20004087
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
|||||||||||||| || |||||| | |||||||||||||||||||||||| |||| | ||||| |||||| ||||| | |||| | |||||||||| |
|
|
| T |
20004206 |
tggaaacagcctctcgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagt |
20004107 |
T |
 |
| Q |
334 |
gcaccggattgcctttttat |
353 |
Q |
| |
|
||||||| ||||| |||||| |
|
|
| T |
20004106 |
gcaccgggttgcccttttat |
20004087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 289
Target Start/End: Original strand, 22324937 - 22324989
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaa |
289 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||| |||||||||||||| |
|
|
| T |
22324937 |
tggaaacagcctcttgtgtaaaaacagggtaaggctgcatacaatacaccaaa |
22324989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 23796509 - 23796613
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||||| ||||||| | |||||| |||||||||||||||||||| | |||| |||||| |||||| | |||| |||||||||||| |
|
|
| T |
23796509 |
tggaaacagcctcttgtgtaaaaatcaatgtaaggttgcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgctggagctttagtgc |
23796608 |
T |
 |
| Q |
336 |
accgg |
340 |
Q |
| |
|
||||| |
|
|
| T |
23796609 |
accgg |
23796613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 35117882 - 35117775
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacacc--aaatgataggacctcttcccggaccctacgt-atgtgagagctttag |
332 |
Q |
| |
|
|||||| |||||||||| ||||| | |||||||||||| |||||||||||| ||||||| ||||| ||||||||||||| ||| ||| ||||||||| |
|
|
| T |
35117882 |
tggaaatagcctcttgtgtaaaatacagggtaaggctgtgtacaatacaccaaaaatgatgggaccccttcccggaccctgcgtaatgcaggagctttag |
35117783 |
T |
 |
| Q |
333 |
tgcaccgg |
340 |
Q |
| |
|
|||||||| |
|
|
| T |
35117782 |
tgcaccgg |
35117775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 251 - 340
Target Start/End: Complemental strand, 31442489 - 31442399
Alignment:
| Q |
251 |
tgtataaaaatagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
|||| ||||| ||||||||| ||||||||||||||| ||||| | ||||| |||||||||| || ||||||| ||||||| ||||||||| |
|
|
| T |
31442489 |
tgtaaaaaaacagggtaaggatgcgtacaatacaccaaaatggtgggaccccttcccggacactgtgtatgtgggagctttggtgcaccgg |
31442399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 34725276 - 34725190
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
34725276 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
34725190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 45812715 - 45812629
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| |||||||||||||| |||||| || | ||| || ||||| ||||||| |||||||||||||||||| |
|
|
| T |
45812715 |
aggggtaaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctgaaaacagtctcttgtgtaa |
45812629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 351
Target Start/End: Complemental strand, 1517395 - 1517310
Alignment:
| Q |
266 |
taaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
||||||||||||||||||||||| || | ||||| |||| | |||||| |||||| ||||||||||||||||| ||||| |||| |
|
|
| T |
1517395 |
taaggctgcgtacaatacaccaattggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgccctttt |
1517310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 256 - 338
Target Start/End: Complemental strand, 19932849 - 19932765
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacacc--aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||| | ||||| ||||||||||||| |||||| ||| | |||||||||| |
|
|
| T |
19932849 |
aaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcacc |
19932765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 340
Target Start/End: Complemental strand, 20999933 - 20999860
Alignment:
| Q |
267 |
aaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
||||||||||||||||||||||||||| || || ||||| | ||||| |||| | | ||||||||||||||||| |
|
|
| T |
20999933 |
aaggctgcgtacaatacaccaaatgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccgg |
20999860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 236 - 289
Target Start/End: Original strand, 33223027 - 33223080
Alignment:
| Q |
236 |
atggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaa |
289 |
Q |
| |
|
|||||||||||||||||| |||||| |||| |||| |||||||||||||||||| |
|
|
| T |
33223027 |
atggaaacagcctcttgtgtaaaaacagggaaaggttgcgtacaatacaccaaa |
33223080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 256 - 336
Target Start/End: Original strand, 43207559 - 43207640
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaat-gataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||| |||||||| | || ||||||||||||||| | | |||||||||||| ||||||| ||||| ||||||||||||||| |
|
|
| T |
43207559 |
aaaaacagggtaagacggcatacaatacaccaaattggtgggacctcttcccagaccctatgtatgcgagagctttagtgca |
43207640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 237 - 353
Target Start/End: Complemental strand, 6983923 - 6983808
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||| | || ||||| |||||||| |||||||||||||||||||| | ||||| ||| ||||||||| |||| | ||||||| ||||| |
|
|
| T |
6983923 |
tggaaacagcctcgtata-aaaaacagggtaagtatgcgtacaatacaccaaatggtgggacccctttccggaccctgcgtaggcaggagctttggtgca |
6983825 |
T |
 |
| Q |
337 |
ccggattgcctttttat |
353 |
Q |
| |
|
|||| |||| |||||| |
|
|
| T |
6983824 |
ccgggctgcccttttat |
6983808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 239 - 289
Target Start/End: Complemental strand, 17470458 - 17470407
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa |
289 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
17470458 |
gaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaa |
17470407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 14617016 - 14617102
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| ||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
14617016 |
aggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacagcctcttgtgtaa |
14617102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 20004272 - 20004186
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| | |||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||| |||| |||||| |
|
|
| T |
20004272 |
aggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctctcgtgtaa |
20004186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 27474259 - 27474345
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| || ||||| |||| ||||||||||||||||||||| |
|
|
| T |
27474259 |
aggggtaaccttagctcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcttggaaacagtctcttgtgtaa |
27474345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 32632736 - 32632650
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| || ||| || | ||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
32632736 |
aggggtaaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
32632650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 41319986 - 41319900
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||| |||||| || | ||| || |||| | ||||||||||||||||||||||||| |
|
|
| T |
41319986 |
aggggtaaccttgacacaactggtaaagttgttgtcatgtgactgaaaggtcacaggtttaagtcctggaaacagtctcttgtgtaa |
41319900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 262 - 340
Target Start/End: Original strand, 43768209 - 43768287
Alignment:
| Q |
262 |
agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
||||||||||||| ||||||||||||| || | ||||| |||||| |||||| ||||| | |||||||| |||||||| |
|
|
| T |
43768209 |
agggtaaggctgcctacaatacaccaattggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgg |
43768287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 155 - 236
Target Start/End: Original strand, 45402077 - 45402158
Alignment:
| Q |
155 |
gtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||| || |||| | |||||||||||| ||||||| ||| ||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
45402077 |
gtaaccttggcgcaactggtaaagttgttgtcatgtgat-ggaaggtaacgggttcaagtcctggaaacagcctcttgtgtaa |
45402158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 46991782 - 46991868
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| | |||| | |||||||||||| |||||| |||| ||| |||||||| ||||||||||||| ||||||||||| |
|
|
| T |
46991782 |
aggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaa |
46991868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 232
Target Start/End: Original strand, 47214489 - 47214571
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgt |
232 |
Q |
| |
|
||||||||| || || |||| | |||||||||||| |||||| || | ||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
47214489 |
aggggtaactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgt |
47214571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 251 - 320
Target Start/End: Complemental strand, 20982849 - 20982780
Alignment:
| Q |
251 |
tgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatg |
320 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||| | ||| |||||| |||||||| |||||| |
|
|
| T |
20982849 |
tgtaaaaaaatagggtaaggctgccaacaatacacctaatggtgggatctcttctcggaccctgcgtatg |
20982780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 239 - 340
Target Start/End: Original strand, 23371170 - 23371270
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||||||| |||| |||||| ||| |||| || ||||||||||||||||| | ||||| ||| || |||||| |||||||| |||||||||||||| |
|
|
| T |
23371170 |
gaaacagccacttgggtaaaaaacgggcaaggttgtgtacaatacaccaaatgctgggacccctt-ccagaccctgcgtatgtggtagctttagtgcacc |
23371268 |
T |
 |
| Q |
339 |
gg |
340 |
Q |
| |
|
|| |
|
|
| T |
23371269 |
gg |
23371270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 313
Target Start/End: Complemental strand, 34149074 - 34148997
Alignment:
| Q |
237 |
tggaaacagcctcttgtata-aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct |
313 |
Q |
| |
|
||||||||||||||||| || |||||||||||||| ||||||||| | |||||||| | |||| ||||| ||||||| |
|
|
| T |
34149074 |
tggaaacagcctcttgtgtagaaaatagggtaaggttgcgtacaaaagaccaaatggtgagaccccttcctggaccct |
34148997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 151 - 227
Target Start/End: Original strand, 34714601 - 34714678
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtct |
227 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| ||||||||| | ||| |||||||| |||| |||||||||||| |
|
|
| T |
34714601 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgattgaaaggtcacgggttcaagtcatggaaacagtct |
34714678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 240 - 338
Target Start/End: Original strand, 19701617 - 19701717
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaatag-ggtaaggctgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtgcac |
337 |
Q |
| |
|
|||||||||||||| |||||| ||||||| || ||||||||||||||| || | || || ||||||||||||| |||||| | |||||||||||||| |
|
|
| T |
19701617 |
aaacagcctcttgtgtaaaaaacttggtaaggatgggtacaatacaccaaaatggtggggccccttcccggaccctgcgtatgcgggagctttagtgcac |
19701716 |
T |
 |
| Q |
338 |
c |
338 |
Q |
| |
|
| |
|
|
| T |
19701717 |
c |
19701717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 237 - 313
Target Start/End: Complemental strand, 22930181 - 22930106
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct |
313 |
Q |
| |
|
|||||||||||| |||| |||||| ||||||||| || | ||||||||||||||| | ||||| ||||| ||||||| |
|
|
| T |
22930181 |
tggaaacagccttttgtgtaaaaacagggtaaggttgtg-acaatacaccaaatggtgggaccccttcctggaccct |
22930106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Original strand, 6925101 - 6925164
Alignment:
| Q |
174 |
taaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| |||||| |||| ||| |||||||| ||||||||||| || ||||||||||| |
|
|
| T |
6925101 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaa |
6925164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 299
Target Start/End: Complemental strand, 18335402 - 18335339
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacc |
299 |
Q |
| |
|
||||||||| ||||||| ||||||| ||||||| | ||||||||||||| |||||||| ||||| |
|
|
| T |
18335402 |
tggaaacagtctcttgtttaaaaattagggtaaagttgcgtacaatacatcaaatgatgggacc |
18335339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Complemental strand, 18724702 - 18724639
Alignment:
| Q |
174 |
taaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| |||||| || | ||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
18724702 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
18724639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 18944621 - 18944707
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| || ||||| || ||||||||||| ||||||||||| |
|
|
| T |
18944621 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaaggcctggaaacagcctcttgtgtaa |
18944707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 22930247 - 22930161
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| | |||||| |||||||||||||| || |||||||| |
|
|
| T |
22930247 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagccttttgtgtaa |
22930161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 156 - 236
Target Start/End: Complemental strand, 30395903 - 30395822
Alignment:
| Q |
156 |
taaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
||||||| || |||| | |||||||||||| |||||| | | ||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
30395903 |
taaccttggcgcaactggtaaagttgttgtcatgtgactttaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
30395822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 295 - 340
Target Start/End: Original strand, 30555218 - 30555263
Alignment:
| Q |
295 |
ggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
||||| |||| |||||||| |||||| ||||||||||||||||||| |
|
|
| T |
30555218 |
ggaccccttcacggaccctgcgtatgcgagagctttagtgcaccgg |
30555263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 39215073 - 39214968
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaata-gggtaaggctgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
|||||||| |||||||| |||||| |||||||||||||||||||| ||||| || | || || |||||| ||||| |||||||| |||||||||| |
|
|
| T |
39215073 |
tggaaacaacctcttgtgtaaaaaactgggtaaggctgcgtacaatattccaaaatggtgggtccccttcccaaaccctgcgtatgtggaagctttagtg |
39214974 |
T |
 |
| Q |
335 |
caccgg |
340 |
Q |
| |
|
|||||| |
|
|
| T |
39214973 |
caccgg |
39214968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 9939505 - 9939612
Alignment:
| Q |
237 |
tggaaacagcctcttgtataa-aaatagggtaaggctgcgtacaatacaccaaa--tgataggacctc-ttcccggaccctacgtatgtgagagctttag |
332 |
Q |
| |
|
|||||||| |||||||| ||| ||| | ||||||| ||||| |||||||||||| || | ||||| | ||| |||||||| |||||| | ||||||||| |
|
|
| T |
9939505 |
tggaaacaacctcttgtttaagaaacatggtaaggttgcgtgcaatacaccaaaaatggtgggacccccttctcggaccctgcgtatgcgggagctttag |
9939604 |
T |
 |
| Q |
333 |
tgcaccgg |
340 |
Q |
| |
|
|||||||| |
|
|
| T |
9939605 |
tgcaccgg |
9939612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 338
Target Start/End: Complemental strand, 28894642 - 28894570
Alignment:
| Q |
266 |
taaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||| ||||||||||||| |||||| || ||| ||||| |||||| | |||| ||||||||||||||||| |
|
|
| T |
28894642 |
taaggttgcgtacaatacatcaaatggtaaaaccccttcctagaccctgcatatgcgagagctttagtgcacc |
28894570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 306 - 350
Target Start/End: Original strand, 50548561 - 50548605
Alignment:
| Q |
306 |
cggaccctacgtatgtgagagctttagtgcaccggattgcctttt |
350 |
Q |
| |
|
||||||||||||||| | |||||||||| ||||| |||||||||| |
|
|
| T |
50548561 |
cggaccctacgtatgcgggagctttagtacaccgaattgcctttt |
50548605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 295 - 351
Target Start/End: Original strand, 50606506 - 50606562
Alignment:
| Q |
295 |
ggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
||||| ||||||||||||| | |||| | ||||||||||||||||| ||||| |||| |
|
|
| T |
50606506 |
ggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
50606562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 337
Target Start/End: Original strand, 50811983 - 50812085
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
|||||||||| |||||| |||||| | |||||||| ||||||||||||||| ||||| | ||||| ||||||| |||| |||||| | |||||||| | |
|
|
| T |
50811983 |
tggaaacagcttcttgtgtaaaaaaacagggtaaggttgcgtacaatacaccaaaatggt-ggaccccttcccgcgccctgcgtatgcgggagctttaat |
50812081 |
T |
 |
| Q |
334 |
gcac |
337 |
Q |
| |
|
|||| |
|
|
| T |
50812082 |
gcac |
50812085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 71; Significance: 6e-32; HSPs: 75)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 236 - 346
Target Start/End: Complemental strand, 6430740 - 6430630
Alignment:
| Q |
236 |
atggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | ||||||||| || |
|
|
| T |
6430740 |
atggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccacttcccggaccctgcgtatgcgggagctttagcgc |
6430641 |
T |
 |
| Q |
336 |
accggattgcc |
346 |
Q |
| |
|
||||| ||||| |
|
|
| T |
6430640 |
accgggttgcc |
6430630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 5648280 - 5648394
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | |||||| |||||| |
|
|
| T |
5648280 |
tggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgca |
5648379 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
| || ||||| |||| |
|
|
| T |
5648380 |
ctgggttgccctttt |
5648394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 40915850 - 40915959
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| |||||| | |||||||||||||||||||||||||||| | ||| | ||||||||||||| |||||| | |||||| |||||| |
|
|
| T |
40915850 |
tggaaacagcctcttgtgtaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgca |
40915949 |
T |
 |
| Q |
337 |
ccggattgcc |
346 |
Q |
| |
|
|||||||||| |
|
|
| T |
40915950 |
ccggattgcc |
40915959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 25629070 - 25629185
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||| ||||||| ||||| |||||||||||||| ||||||||||||||||| | ||||| ||||||||||||||| |||| | |||||||||||| |
|
|
| T |
25629070 |
tggaaacagtctcttgtgtaaaaaatagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctacatatgcgggagctttagtgc |
25629169 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
||||| ||||| |||| |
|
|
| T |
25629170 |
accgggttgccctttt |
25629185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 20639773 - 20639657
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||| || | ||||| ||||||||||||| |||||| | ||||||||||| |
|
|
| T |
20639773 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg |
20639674 |
T |
 |
| Q |
335 |
caccggattgccttttt |
351 |
Q |
| |
|
|||||| ||||| |||| |
|
|
| T |
20639673 |
caccgggttgccctttt |
20639657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 30639401 - 30639515
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||| ||||||| |||||| |||||||||||||||||||||||||||||| | |||| ||||||||||||| | |||| | ||||||||||||| |
|
|
| T |
30639401 |
tggaaacagactcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgagaccccttcccggaccctgcatatgcgggagctttagtgca |
30639500 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
| || ||||| |||| |
|
|
| T |
30639501 |
ctgggttgccctttt |
30639515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 47528642 - 47528529
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| ||||| ||||||| |
|
|
| T |
47528642 |
tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgaatatgtgggagctctagtgca |
47528544 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
47528543 |
ccgggttgccctttt |
47528529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 237 - 322
Target Start/End: Complemental strand, 5306777 - 5306692
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtg |
322 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| |||||||||||||||||||| | ||||| ||||||||||||| |||||||| |
|
|
| T |
5306777 |
tggaaacagcctcttgtgtaaaatcagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgtg |
5306692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 20225005 - 20225113
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||| |||||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
20225005 |
tggaaacaacctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
20225103 |
T |
 |
| Q |
337 |
ccggattgcc |
346 |
Q |
| |
|
|||| ||||| |
|
|
| T |
20225104 |
ccgggttgcc |
20225113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 240 - 352
Target Start/End: Complemental strand, 51865149 - 51865036
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
|||||||||||||| |||||| | |||||||||||||||||||||||||||| | || || ||||||||||||| |||||| | |||||||| |||||| |
|
|
| T |
51865149 |
aaacagcctcttgtgtaaaaaacatggtaaggctgcgtacaatacaccaaatggtggggccccttcccggaccctgcgtatgcgggagctttattgcacc |
51865050 |
T |
 |
| Q |
339 |
ggattgccttttta |
352 |
Q |
| |
|
||| |||| ||||| |
|
|
| T |
51865049 |
ggactgccctttta |
51865036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 7909394 - 7909284
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatg-tgagagctttagtgc |
335 |
Q |
| |
|
||||||||| ||||||| |||||| ||||||||| |||||||||||||||||||| | ||||| ||||||| ||||| |||||| | |||||||||||| |
|
|
| T |
7909394 |
tggaaacagtctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcggggagctttagtgc |
7909295 |
T |
 |
| Q |
336 |
accggattgcc |
346 |
Q |
| |
|
| ||| ||||| |
|
|
| T |
7909294 |
atcgggttgcc |
7909284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 48598937 - 48598824
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||| | | |||| ||||| ||||||| |
|
|
| T |
48598937 |
tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccatgcatatgccggagctctagtgca |
48598839 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
48598838 |
ccgggttgccctttt |
48598824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 240 - 340
Target Start/End: Original strand, 54175088 - 54175190
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacacc-aaatgataggacctctt-cccggaccctacgtatgtgagagctttagtgcac |
337 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||| ||||| | ||||| ||| |||||||||| | |||| | |||||||||||||| |
|
|
| T |
54175088 |
aaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttccccggaccctgcatatgcgggagctttagtgcac |
54175187 |
T |
 |
| Q |
338 |
cgg |
340 |
Q |
| |
|
||| |
|
|
| T |
54175188 |
cgg |
54175190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 257 - 346
Target Start/End: Complemental strand, 29207991 - 29207902
Alignment:
| Q |
257 |
aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc |
346 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||||||| ||||| |
|
|
| T |
29207991 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
29207902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 239 - 334
Target Start/End: Original strand, 14983857 - 14983953
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| ||| |||||||||| ||||| | ||||| ||||||||||||| |||||| | ||||||||||| |
|
|
| T |
14983857 |
gaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg |
14983953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 329
Target Start/End: Original strand, 49796819 - 49796911
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctt |
329 |
Q |
| |
|
||||||||||||||||| | |||| | |||||||||||||||||||||||||||| | ||||| ||||||| ||||| |||||| | |||||| |
|
|
| T |
49796819 |
tggaaacagcctcttgtgttaaaacatggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctt |
49796911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 240 - 351
Target Start/End: Complemental strand, 9832422 - 9832312
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg |
339 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| || || |||||||||| |
|
|
| T |
9832422 |
aaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcaggaactctagtgcaccg |
9832324 |
T |
 |
| Q |
340 |
gattgccttttt |
351 |
Q |
| |
|
| ||||| |||| |
|
|
| T |
9832323 |
ggttgccctttt |
9832312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 47443978 - 47444093
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| |||||| ||||| |
|
|
| T |
47443978 |
tggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcaggagcttcagtgc |
47444077 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
|| || ||||| |||| |
|
|
| T |
47444078 |
actgggttgccctttt |
47444093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 239 - 353
Target Start/End: Original strand, 16911585 - 16911702
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||| || |||| |||||||||||||||||||||||||| |||| | ||||| ||||||||||||| |||| | | |||||||||| |
|
|
| T |
16911585 |
gaaacagcctcttgtgtacaaatcagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtacgcgggagctttagttt |
16911684 |
T |
 |
| Q |
336 |
accggattgcctttttat |
353 |
Q |
| |
|
||||| ||||| |||||| |
|
|
| T |
16911685 |
accgggttgcccttttat |
16911702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 256 - 338
Target Start/End: Complemental strand, 30690270 - 30690188
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||| || | ||||| ||||||||||||| |||||| | ||||||||||||||| |
|
|
| T |
30690270 |
aaaaacagggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcacc |
30690188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 39077908 - 39077795
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| ||||||||||| |||||||| | ||| |||| ||||||||| | |||| | ||||| ||||||| |
|
|
| T |
39077908 |
tggaaacagcctcttgtgtaaaac-agggtaaggttgcgtacaatataccaaatggtgagacatctttccggaccctgcatatgcgggagctctagtgca |
39077810 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
39077809 |
ccgggttgccttttt |
39077795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 239 - 339
Target Start/End: Original strand, 54730272 - 54730376
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaa--tagggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
||||||||||||||| |||||| |||| |||||||||||| |||||||||| ||||| | ||| ||||||||||||| |||||| | ||||||||||| |
|
|
| T |
54730272 |
gaaacagcctcttgtgtaaaaaaataggataaggctgcgtataatacaccaataatgatggaaccccttcccggaccctgcgtatgcgggagctttagtg |
54730371 |
T |
 |
| Q |
335 |
caccg |
339 |
Q |
| |
|
||||| |
|
|
| T |
54730372 |
caccg |
54730376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 313
Target Start/End: Complemental strand, 17043508 - 17043431
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct |
313 |
Q |
| |
|
||||||||||||||||| ||||| | |||||||||||||||||||||||||||||| | ||||| |||||| |||||| |
|
|
| T |
17043508 |
tggaaacagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccagaccct |
17043431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 256 - 341
Target Start/End: Original strand, 19027889 - 19027974
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgga |
341 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| || | ||||| ||| || ||| || |||||||| |||||||||||||||||| |
|
|
| T |
19027889 |
aaaaacagggtaaggctgcgtacaatacaccaattggtgggacccctttccagactctgcgtatgtgggagctttagtgcaccgga |
19027974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 21646985 - 21647097
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||| |||| |||| | ||||| |||||| ||||| | |||| | |||||||||| |
|
|
| T |
21646985 |
tggaaacagcctcttgtgtaaaaaatagggtaaggctgcgtacaatataccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagt |
21647084 |
T |
 |
| Q |
334 |
gcaccggattgcc |
346 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
21647085 |
gcaccgggttgcc |
21647097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 242 - 351
Target Start/End: Original strand, 23501813 - 23501925
Alignment:
| Q |
242 |
acagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
|||||||||||| |||||| ||||||||| ||||||||||||||||| ||| | ||||| ||||||||||||| | |||| | ||||||||||||||| |
|
|
| T |
23501813 |
acagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
23501912 |
T |
 |
| Q |
339 |
ggattgccttttt |
351 |
Q |
| |
|
|| ||||| |||| |
|
|
| T |
23501913 |
gggttgccctttt |
23501925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 239 - 351
Target Start/End: Complemental strand, 10277867 - 10277756
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||||||| | ||| |||||| |||||| | |||| | ||| | ||||| ||| |
|
|
| T |
10277867 |
gaaacagcctcttgtataaaa-taggataaggctgcgtacaatacaccaaatggtgaaaccccttcccagaccctgcatatgcgggagttctagtgaacc |
10277769 |
T |
 |
| Q |
339 |
ggattgccttttt |
351 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
10277768 |
ggattgccctttt |
10277756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 35567191 - 35567295
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||| ||||| |||||| |||||||||||| |||||| |||||||||| | ||||| ||||||| ||||| ||| || | |||||||||||| |
|
|
| T |
35567191 |
tggaaacagccacttgtgtaaaaaacagggtaaggctgtgtacaacacaccaaatggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgc |
35567290 |
T |
 |
| Q |
336 |
accgg |
340 |
Q |
| |
|
||||| |
|
|
| T |
35567291 |
accgg |
35567295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 9987948 - 9987833
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaa-aatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||| |||||||| |||| |||||||||||||||| |||||||||||||||| | ||||| ||||| |||| | | |||| | |||||||| ||| |
|
|
| T |
9987948 |
tggaaacaacctcttgtgtaaacaatagggtaaggctgcatacaatacaccaaatggtgggaccccttccttgaccttgcatatgcgggagctttaatgc |
9987849 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
9987848 |
accgggctgccttttt |
9987833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 16408717 - 16408600
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||||||||||||||||| |||| | | ||| |||||||||||| | |||| | |||||||||| |
|
|
| T |
16408717 |
tggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaataatggtggaaccccttcccggaccccgcatatgcgggagctttagt |
16408618 |
T |
 |
| Q |
334 |
gcaccggattgccttttt |
351 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
16408617 |
gcaccgggttgccctttt |
16408600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 41018907 - 41018807
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||| |||||||| ||||| |||||||||||| ||||||||||||||||| | ||||| |||||| |||| | |||||| | ||||||||||| |
|
|
| T |
41018907 |
tggaaacaacctcttgtgtaaaattagggtaaggctacgtacaatacaccaaatagtgggaccccttcccagaccttgcgtatggaggggctttagtgca |
41018808 |
T |
 |
| Q |
337 |
c |
337 |
Q |
| |
|
| |
|
|
| T |
41018807 |
c |
41018807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 264 - 351
Target Start/End: Complemental strand, 3580926 - 3580840
Alignment:
| Q |
264 |
ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
|||||||||| || |||||||||||||| ||||||| ||||||||||||| | |||||| ||||||| |||||| ||| |||| |||| |
|
|
| T |
3580926 |
ggtaaggctgtgtgcaatacaccaaatgctaggaccccttcccggaccctgcatatgtgggagcttt-gtgcacgggactgccatttt |
3580840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 240 - 351
Target Start/End: Complemental strand, 11054257 - 11054147
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg |
339 |
Q |
| |
|
|||||| ||||||| ||||| |||||||| ||||||||||||||||||||| | ||| ||||||||||||| | |||| | ||||| |||||||||| |
|
|
| T |
11054257 |
aaacagtctcttgtgtaaaac-agggtaagactgcgtacaatacaccaaatggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccg |
11054159 |
T |
 |
| Q |
340 |
gattgccttttt |
351 |
Q |
| |
|
| ||||| |||| |
|
|
| T |
11054158 |
ggttgccctttt |
11054147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 262 - 346
Target Start/End: Original strand, 20225121 - 20225207
Alignment:
| Q |
262 |
agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc |
346 |
Q |
| |
|
|||||||||||||||||||||||||| |||| | ||||| |||||||||||| | |||| | ||||||||||||||||| ||||| |
|
|
| T |
20225121 |
agggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcc |
20225207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 239 - 313
Target Start/End: Complemental strand, 47441642 - 47441567
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct |
313 |
Q |
| |
|
||||||| ||||| | ||||||| |||||||||||| ||||||||||||||||| | ||||| ||||||||||||| |
|
|
| T |
47441642 |
gaaacagtctcttttgtaaaaatcagggtaaggctgtgtacaatacaccaaatggttggaccccttcccggaccct |
47441567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 146 - 236
Target Start/End: Complemental strand, 48599008 - 48598917
Alignment:
| Q |
146 |
ggataaggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||| |||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
48599008 |
ggatgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
48598917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 55766579 - 55766476
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||| |||||| | ||| |||||||||||||||||||||||| |||| | | ||| | ||||||||| | |||||| ||||||||||||||| |
|
|
| T |
55766579 |
tggaaacagtttcttgtgtgtaaacagggtaaggctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgca |
55766480 |
T |
 |
| Q |
337 |
ccgg |
340 |
Q |
| |
|
|||| |
|
|
| T |
55766479 |
ccgg |
55766476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 5648214 - 5648300
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
5648214 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
5648300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 264 - 337
Target Start/End: Complemental strand, 20908723 - 20908649
Alignment:
| Q |
264 |
ggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac |
337 |
Q |
| |
|
||||||||||||||||||||||| ||||| | ||||| ||||||| ||||| |||||| | |||||||||||||| |
|
|
| T |
20908723 |
ggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac |
20908649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 240 - 346
Target Start/End: Complemental strand, 44363243 - 44363134
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||||| ||| |||||| |||||| |||||||||||| ||||||| || | ||||| ||||||||||||| |||||| | ||||||||||||| |
|
|
| T |
44363243 |
aaacagcctcgtgtgtaaaaaacagggtagggctgcgtacaacgcaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca |
44363144 |
T |
 |
| Q |
337 |
ccggattgcc |
346 |
Q |
| |
|
|||| ||||| |
|
|
| T |
44363143 |
ccgggttgcc |
44363134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 338
Target Start/End: Complemental strand, 55830834 - 55830733
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||| ||||||| | ||| ||||||| |||||||||||||||| |||| | | ||| | ||||||||| | |||||| ||||||||||||||| |
|
|
| T |
55830834 |
tggaaacagtctcttgtgtgtaaacagggtaatgctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgca |
55830735 |
T |
 |
| Q |
337 |
cc |
338 |
Q |
| |
|
|| |
|
|
| T |
55830734 |
cc |
55830733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 236
Target Start/End: Complemental strand, 16408777 - 16408697
Alignment:
| Q |
157 |
aaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
16408777 |
aaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
16408697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 8473734 - 8473624
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctctt-cccgga-ccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
||||||||||||||||| | || ||||||||||||| |||||||||||||||| | ||||| ||| |||||| |||| | |||| | ||||||||||| |
|
|
| T |
8473734 |
tggaaacagcctcttgtgtttaac-agggtaaggctgcatacaatacaccaaatggtgggaccccttccccggacccctgcatatgcgggagctttagtg |
8473636 |
T |
 |
| Q |
335 |
caccggattgcc |
346 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
8473635 |
caccgggttgcc |
8473624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 236 - 339
Target Start/End: Complemental strand, 30496435 - 30496333
Alignment:
| Q |
236 |
atggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||||||||||||| |||| | |||||||||||| |||||||||||||||| |||| ||||||||||| | | |||| |||||||||||| |
|
|
| T |
30496435 |
atggaaacagcctcttgtgtaaacac-gggtaaggctgcatacaatacaccaaatggggggactccttcccggaccgtgcttatgatggagctttagtgc |
30496337 |
T |
 |
| Q |
336 |
accg |
339 |
Q |
| |
|
|||| |
|
|
| T |
30496336 |
accg |
30496333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 5306843 - 5306757
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||| ||| |||||| || | ||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
5306843 |
aggggtaaccttggcgcaactggtaaagttgatgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
5306757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 11054326 - 11054240
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
||||||||| || || |||| | |||||||||||| |||||| || | ||| ||||||||| |||||| |||||||||||||||||| |
|
|
| T |
11054326 |
aggggtaactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctgaaaacagtctcttgtgtaa |
11054240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 21646919 - 21647005
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||| ||||||| || |||| | |||||||||||| |||||| |||| ||| || |||||| ||||||||||||| ||||||||||| |
|
|
| T |
21646919 |
agggataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacagcctcttgtgtaa |
21647005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 313
Target Start/End: Complemental strand, 7385590 - 7385513
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct |
313 |
Q |
| |
|
||||||||||||| ||| |||||| |||||||||| || || |||||||||||||| | ||||| |||||||||||| |
|
|
| T |
7385590 |
tggaaacagcctcatgtgtaaaaaatagggtaaggttgtgtgcaatacaccaaatggtgggaccctttcccggaccct |
7385513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 256 - 338
Target Start/End: Original strand, 25343228 - 25343312
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaat--gataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| | | ||||| ||||| || ||| |||||||||||||||||| ||||| |
|
|
| T |
25343228 |
aaaaacagggtaaggctgcgtacaatacaccaaaaagggttggaccccttcctagatcctgcgtatgtgagagctttagagcacc |
25343312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 265 - 339
Target Start/End: Complemental strand, 30352667 - 30352591
Alignment:
| Q |
265 |
gtaaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg |
339 |
Q |
| |
|
|||| |||||||||||||||||||| || | ||||| |||| |||||||| |||||| | |||||||||||||||| |
|
|
| T |
30352667 |
gtaaagctgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccg |
30352591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 334
Target Start/End: Complemental strand, 30581581 - 30581481
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
|||||||| |||||||| |||||| | |||||||| || |||||||||||| ||||| | ||||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
30581581 |
tggaaacaacctcttgtgtaaaaaaacagggtaagggtgtgtacaatacaccaaaatggtgggaccccttcccggaccctgcatatgtaggagctttagt |
30581482 |
T |
 |
| Q |
334 |
g |
334 |
Q |
| |
|
| |
|
|
| T |
30581481 |
g |
30581481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 332
Target Start/End: Complemental strand, 39029175 - 39029078
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacac-caaatgataggacctcttcccggaccctacgtatgtgagagctttag |
332 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||| ||||||||||| ||||| | ||||| ||| ||||||||| | |||| | ||||||||| |
|
|
| T |
39029175 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacgaaaatggtgggaccactttccggaccctgcatatgcgggagctttag |
39029078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 251 - 291
Target Start/End: Complemental strand, 12711548 - 12711508
Alignment:
| Q |
251 |
tgtataaaaatagggtaaggctgcgtacaatacaccaaatg |
291 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12711548 |
tgtaaaaaaatagggtaagactgcgtacaatacaccaaatg |
12711508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 239 - 334
Target Start/End: Complemental strand, 32629380 - 32629285
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||| || ||| |||||||||| || ||||| ||||||||||| | |||||||| ||| ||||||| |
|
|
| T |
32629380 |
gaaacagcctcttgtaaaaaaacagggtaaggccgcctac-atacaccaaattggcgggaccccttcccggaccttgcgtatgtgggagttttagtg |
32629285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 237 - 336
Target Start/End: Original strand, 37494872 - 37494972
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||| |||||||| |||||| ||||||||| ||| ||||||| |||||||| | ||||| ||| | ||||||| |||||| |||||||||||| |
|
|
| T |
37494872 |
tggaaacaacctcttgtgtaaaaaacagggtaaggttgcatacaatataccaaatggtgggacccctttcgggaccctgcgtatgcaggagctttagtgc |
37494971 |
T |
 |
| Q |
336 |
a |
336 |
Q |
| |
|
| |
|
|
| T |
37494972 |
a |
37494972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 279 - 351
Target Start/End: Original strand, 38786673 - 38786745
Alignment:
| Q |
279 |
aatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||||||| ||||| |||| |
|
|
| T |
38786673 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
38786745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 39077948 - 39077888
Alignment:
| Q |
177 |
agttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
||||||||| ||||||||| | ||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
39077948 |
agttgttgtcatgtgattgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
39077888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 244 - 351
Target Start/End: Complemental strand, 13256508 - 13256398
Alignment:
| Q |
244 |
agcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||| ||| | ||||| ||||||| |||| | | || | ||||||||||||||||| |
|
|
| T |
13256508 |
agcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgg |
13256409 |
T |
 |
| Q |
341 |
attgccttttt |
351 |
Q |
| |
|
||||| |||| |
|
|
| T |
13256408 |
gttgccctttt |
13256398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 32478899 - 32478802
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||| ||||| || |||||| |||||||||||| ||||||||||||| | ||||| |||||||||||| |||||| | ||||||| ||||| |
|
|
| T |
32478899 |
tggaaacaacctctagtgtaaaaacagggtaaggctg-----aatacaccaaatggtgggaccccttcccggacccagcgtatgcgggagcttt-gtgca |
32478806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 295 - 346
Target Start/End: Complemental strand, 38755963 - 38755912
Alignment:
| Q |
295 |
ggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc |
346 |
Q |
| |
|
||||| ||||||||||||| |||||| | ||||||||||||||||| ||||| |
|
|
| T |
38755963 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
38755912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 20224939 - 20225025
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| | |||||| ||||||||||||| ||||||||||| |
|
|
| T |
20224939 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaa |
20225025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 237 - 337
Target Start/End: Original strand, 21489108 - 21489210
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
|||||||||||||||| |||||| || ||||| ||||||||||| |||| ||||| | ||||| ||||||| ||||| |||||| | ||||||| ||| |
|
|
| T |
21489108 |
tggaaacagcctcttgcgtaaaaaacagagtaagactgcgtacaatgcaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttcgtg |
21489207 |
T |
 |
| Q |
335 |
cac |
337 |
Q |
| |
|
||| |
|
|
| T |
21489208 |
cac |
21489210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 237 - 330
Target Start/End: Original strand, 25463143 - 25463237
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaata-gggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttt |
330 |
Q |
| |
|
|||||||| |||||||| |||||| ||| |||| ||||||||| |||||||||| | ||||| ||||||||||||| | |||| | ||||||| |
|
|
| T |
25463143 |
tggaaacaacctcttgtgtaaaaaactgggaaaggttgcgtacaacacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt |
25463237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 30639335 - 30639421
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| ||||| || | ||| || |||||| ||||||||||||| ||||||||||| |
|
|
| T |
30639335 |
aggggtaaccttggcgcaactggtaaagttgttgtcttgtgactgaaaggtcactggttcaagtcctggaaacagactcttgtgtaa |
30639421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 276 - 351
Target Start/End: Complemental strand, 33836563 - 33836486
Alignment:
| Q |
276 |
tacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
||||||||||||| ||| | ||||| ||||||||||||| |||||| | ||||||||||||| ||| ||||| |||| |
|
|
| T |
33836563 |
tacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccctttt |
33836486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 301 - 351
Target Start/End: Original strand, 35532078 - 35532128
Alignment:
| Q |
301 |
cttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
||||||||||||| |||||| | ||||||||||||||||| ||||| |||| |
|
|
| T |
35532078 |
cttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
35532128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 296 - 346
Target Start/End: Complemental strand, 40553991 - 40553941
Alignment:
| Q |
296 |
gacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc |
346 |
Q |
| |
|
|||| ||||||||||||| |||||| | ||||||||||||||||| ||||| |
|
|
| T |
40553991 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
40553941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 47528708 - 47528622
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| | |||| | |||||||||||| |||||| || | ||| || |||||| ||||||||||||| ||||||||||| |
|
|
| T |
47528708 |
aggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaa |
47528622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 255 - 340
Target Start/End: Original strand, 15053973 - 15054058
Alignment:
| Q |
255 |
taaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
|||||||||||||||| || |||||| ||| |||||||| | ||||| |||||| |||||||| | || |||||||||||||| |
|
|
| T |
15053973 |
taaaaatagggtaaggttgtgtacaaaacatcaaatgatgaaatttcttcacggaccttacgtatgcgggaactttagtgcaccgg |
15054058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 286 - 346
Target Start/End: Original strand, 11394923 - 11394983
Alignment:
| Q |
286 |
caaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc |
346 |
Q |
| |
|
|||||| | ||||| ||| ||||||||| |||||| | ||||||||||||||||| ||||| |
|
|
| T |
11394923 |
caaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
11394983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 286 - 346
Target Start/End: Original strand, 11404650 - 11404710
Alignment:
| Q |
286 |
caaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc |
346 |
Q |
| |
|
|||||| | ||||| ||| ||||||||| |||||| | ||||||||||||||||| ||||| |
|
|
| T |
11404650 |
caaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
11404710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 239 - 300
Target Start/End: Original strand, 14590860 - 14590923
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacaccaaatgataggacct |
300 |
Q |
| |
|
||||||||||||||| |||||| | |||||||||||| ||||||||| |||||| | |||||| |
|
|
| T |
14590860 |
gaaacagcctcttgtctaaaaaaacagggtaaggctgcatacaatacatcaaatggtgggacct |
14590923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 153 - 236
Target Start/End: Original strand, 14983791 - 14983875
Alignment:
| Q |
153 |
gggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||| ||| ||| | |||||||||||| || |||||||| ||| |||| ||| |||| | ||||||| ||||||||||| |
|
|
| T |
14983791 |
gggtaaccttggcagaactggtaaagttgttgtcatatgattggaaggtcacggattcaagtctttgaaacagcctcttgtgtaa |
14983875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 295 - 351
Target Start/End: Original strand, 32484313 - 32484369
Alignment:
| Q |
295 |
ggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
||||| ||||||||||||| | |||| | ||||||||||||||||| ||||| |||| |
|
|
| T |
32484313 |
ggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
32484369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 236 - 287
Target Start/End: Original strand, 51420594 - 51420646
Alignment:
| Q |
236 |
atggaaacagcctcttgtata-aaaatagggtaaggctgcgtacaatacacca |
287 |
Q |
| |
|
||||||||| |||||||| || |||| |||||||||||| ||||||||||||| |
|
|
| T |
51420594 |
atggaaacaacctcttgtgtagaaaacagggtaaggctgggtacaatacacca |
51420646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 68; Significance: 4e-30; HSPs: 66)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 237 - 352
Target Start/End: Original strand, 9671202 - 9671316
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | ||||||||||||| |
|
|
| T |
9671202 |
tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca |
9671300 |
T |
 |
| Q |
337 |
ccggattgccttttta |
352 |
Q |
| |
|
|||| ||||| ||||| |
|
|
| T |
9671301 |
ccgggttgccctttta |
9671316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 237 - 354
Target Start/End: Complemental strand, 8455430 - 8455312
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||||| ||||| | |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| |||||||||||| |
|
|
| T |
8455430 |
tggaaacagcctcttgtgtaaaacacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgccggagctttagtgc |
8455331 |
T |
 |
| Q |
336 |
accggattgcctttttata |
354 |
Q |
| |
|
||||| ||||| ||||||| |
|
|
| T |
8455330 |
accgggttgcccttttata |
8455312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 10546183 - 10546299
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
|||||||| ||||||||||||||| | ||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | ||||||||||| |
|
|
| T |
10546183 |
tggaaacatcctcttgtataaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg |
10546282 |
T |
 |
| Q |
335 |
caccggattgccttttt |
351 |
Q |
| |
|
|||||| ||||| |||| |
|
|
| T |
10546283 |
caccgggttgccctttt |
10546299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 14444750 - 14444864
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||| |||| |||||||||||| | ||||| ||||||||||||| |||||| | ||||||||||||| |
|
|
| T |
14444750 |
tggaaacagcctcttgtgtaaaaacagggtaaggctgtgtacgatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca |
14444849 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|| | ||||| |||| |
|
|
| T |
14444850 |
ccaggttgccctttt |
14444864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 36871514 - 36871627
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| | |||| |||||||||||||||||||||||||||||| | ||||| ||||||||| ||| |||||| | ||||||||||||| |
|
|
| T |
36871514 |
tggaaacagcctcttgtgtgaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgga-cctgcgtatgcgggagctttagtgca |
36871612 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
36871613 |
ccgggttgccctttt |
36871627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 237 - 356
Target Start/End: Original strand, 11514457 - 11514576
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||||| |||||| | ||||||||||||||||||||||||||| | ||||| |||||| |||||| |||||| | |||||||||||| |
|
|
| T |
11514457 |
tggaaacagcctcttgtgtaaaaaacaaagtaaggctgcgtacaatacaccaaatggtgggacc-cttcccagaccctgcgtatgcgggagctttagtgc |
11514555 |
T |
 |
| Q |
336 |
accggattgcctttttatatg |
356 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
11514556 |
accggattgcccttttatatg |
11514576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 12024032 - 12023929
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| | ||||||||||| ||||| || ||||||| |||| |
|
|
| T |
12024032 |
tggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccctcccggaccctgcgtatttggaagctttaatgca |
12023933 |
T |
 |
| Q |
337 |
ccgg |
340 |
Q |
| |
|
|||| |
|
|
| T |
12023932 |
ccgg |
12023929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 236 - 351
Target Start/End: Complemental strand, 25249852 - 25249737
Alignment:
| Q |
236 |
atggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||||| ||||||| || ||| |||||||||||||||||||||||||||||| | ||| | ||||||| ||||| |||||| | |||||||||||| |
|
|
| T |
25249852 |
atggaaacagtctcttgtgtacaaacagggtaaggctgcgtacaatacaccaaatggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgc |
25249753 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
||||| ||||| |||| |
|
|
| T |
25249752 |
accgggttgccctttt |
25249737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 344
Target Start/End: Original strand, 30826058 - 30826164
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||||||||| | ||| | |||||| |||||||| |||| | ||||||||||||| |
|
|
| T |
30826058 |
tggaaacagcctcttgtgtaaaaatagggtaaggttgcgtacaatacaccaaatggt-ggaacccttcccagaccctacatatgcgggagctttagtgca |
30826156 |
T |
 |
| Q |
337 |
ccggattg |
344 |
Q |
| |
|
|| ||||| |
|
|
| T |
30826157 |
ccagattg |
30826164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 24200739 - 24200622
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||| || | ||| | ||||||||||||| |||||||||||||||||| |
|
|
| T |
24200739 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaacccttcccggaccctgagtatgtgagagctttagt |
24200640 |
T |
 |
| Q |
334 |
gcaccggattgccttttt |
351 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
24200639 |
gcaccgggttgccctttt |
24200622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 24860100 - 24859987
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||| ||||| || |||||| | |||| ||||||||||||||||||||||| ||| ||| |||| |||||||| |||||| | ||||||||||||| |
|
|
| T |
24860100 |
tggaaacaacctctggtgtaaaaacatggta-ggctgcgtacaatacaccaaatggtagaaccccttctcggaccctgcgtatgcgggagctttagtgca |
24860002 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
24860001 |
ccggattgccttttt |
24859987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 14530339 - 14530451
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||| | ||||| ||||||||||||| |||||| | |||||||||| |
|
|
| T |
14530339 |
tggaaacagcctcttgtataaaaaacagggtaaggctacgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagt |
14530438 |
T |
 |
| Q |
334 |
gcaccggattgcc |
346 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
14530439 |
gcaccgggttgcc |
14530451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 23397787 - 23397895
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||| |||||||||||||||||| | ||||| |||| |||||||||| |||| | ||||| ||||||| |
|
|
| T |
23397787 |
tggaaacagcctcttgtgtaaaa-tagggtaaggctacgtacaatacaccaaatggtgggaccccttctcggaccctacatatgcgggagctctagtgca |
23397885 |
T |
 |
| Q |
337 |
ccggattgcc |
346 |
Q |
| |
|
|||| ||||| |
|
|
| T |
23397886 |
ccgggttgcc |
23397895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 40762348 - 40762238
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaata-gggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||| |||||||||||||||||| | ||||| |||| ||||||| |||||||| |||||||||||| |
|
|
| T |
40762348 |
tggaaacagcctcttgtgtaaaaaactgggtaaggctacgtacaatacaccaaatggtgggaccctttcctggaccctgcgtatgtgggagctttagtgc |
40762249 |
T |
 |
| Q |
336 |
accggattgcc |
346 |
Q |
| |
|
||||| ||||| |
|
|
| T |
40762248 |
accgggttgcc |
40762238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 10543719 - 10543831
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||| ||||||||| |||||| |||||||||||||||||||||||||||| || | ||||| ||||||||||||| |||||| | |||||||||| |
|
|
| T |
10543719 |
tggaaacggcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagt |
10543818 |
T |
 |
| Q |
334 |
gcaccggattgcc |
346 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
10543819 |
gcaccgggttgcc |
10543831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 251 - 336
Target Start/End: Original strand, 17896296 - 17896381
Alignment:
| Q |
251 |
tgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||| | ||||| |||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
17896296 |
tgtaaaaaaatagggtaaggctgcgtacaatataccaaatggtgggaccccttctcggaccctgcgtatgtgggagctttagtgca |
17896381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 237 - 353
Target Start/End: Complemental strand, 21779373 - 21779258
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||| |||||||||||| ||||| ||||||||| |||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
21779373 |
tggagacagcctcttgtgtaaaac-agggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
21779275 |
T |
 |
| Q |
337 |
ccggattgcctttttat |
353 |
Q |
| |
|
|||| ||||| |||||| |
|
|
| T |
21779274 |
ccgggttgcccttttat |
21779258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 17668023 - 17668138
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||| | |||||||| ||||||| |||||||||||||||||||||||||||||| | | ||| |||| || ||||| ||||| || |||||||||||| |
|
|
| T |
17668023 |
tggaaagaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacaccaaatggtggaaccccttctcgaaccctgcgtatatgggagctttagtgc |
17668122 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
||||| ||||| |||| |
|
|
| T |
17668123 |
accgggttgccctttt |
17668138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 251 - 352
Target Start/End: Complemental strand, 26684719 - 26684617
Alignment:
| Q |
251 |
tgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattg-ccttt |
349 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||| || ||||| | ||||||||||||| ||||| |||||| | |||||||| |||||||||||| ||||| |
|
|
| T |
26684719 |
tgtaaaaaaatatggtaaggctgcgtacaatatactaaatggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccggattgtccttt |
26684620 |
T |
 |
| Q |
350 |
tta |
352 |
Q |
| |
|
||| |
|
|
| T |
26684619 |
tta |
26684617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 239 - 351
Target Start/End: Original strand, 17623587 - 17623700
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac |
337 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||||||||||||||||||||| | | ||| ||||||| | ||| |||||||| ||||||||||||| |
|
|
| T |
17623587 |
gaaacaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcac |
17623686 |
T |
 |
| Q |
338 |
cggattgccttttt |
351 |
Q |
| |
|
|| ||||| |||| |
|
|
| T |
17623687 |
tgggttgccctttt |
17623700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 251 - 346
Target Start/End: Complemental strand, 25079816 - 25079721
Alignment:
| Q |
251 |
tgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc |
346 |
Q |
| |
|
|||| ||||| | ||||||| ||||||||||||||| |||| | ||||| ||||||||||||| |||||| |||||||||||||||||| ||||| |
|
|
| T |
25079816 |
tgtaaaaaaacaaggtaaggatgcgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgcc |
25079721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 239 - 340
Target Start/End: Complemental strand, 4516463 - 4516361
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac |
337 |
Q |
| |
|
||||||||||||||| |||||| |||| || ||||||||||||||||||| || | ||||| ||||||||||||| |||||||| |||||||||| || |
|
|
| T |
4516463 |
gaaacagcctcttgtgtaaaaaacagggcaacgctgcgtacaatacaccaattggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtac |
4516364 |
T |
 |
| Q |
338 |
cgg |
340 |
Q |
| |
|
||| |
|
|
| T |
4516363 |
cgg |
4516361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 313
Target Start/End: Original strand, 22371078 - 22371152
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct |
313 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |
|
|
| T |
22371078 |
tggaaacagcctcgtgta--aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
22371152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 344
Target Start/End: Original strand, 25641523 - 25641630
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||||| | |||| | |||| ||||||| | ||||||||||||||||||| | ||||| ||||||| | ||| |||||| ||||||||||||| | |
|
|
| T |
25641523 |
tggaaacagcattttgtgtgaaaacagggtaaagttgcgtacaatacaccaaattgtgggaccccttcccgaatcctgcgtatgcgagagctttagtgaa |
25641622 |
T |
 |
| Q |
337 |
ccggattg |
344 |
Q |
| |
|
|||||||| |
|
|
| T |
25641623 |
ccggattg |
25641630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 236 - 291
Target Start/End: Complemental strand, 30864531 - 30864476
Alignment:
| Q |
236 |
atggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatg |
291 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
30864531 |
atggaaacagcctcttgtgtaaaaatagggtaagggtgcgtacaatataccaaatg |
30864476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 236 - 346
Target Start/End: Complemental strand, 40416986 - 40416875
Alignment:
| Q |
236 |
atggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
||||||||| ||||||||||||||| |||| ||||||| |||||||||||||| |||| ||||| || ||||||| | |||| ||||||||||||| |
|
|
| T |
40416986 |
atggaaacaacctcttgtataaaaaacagggaaaggctgtgtacaatacaccaattgatgggacccttttttggaccctgcatatgcgagagctttagtg |
40416887 |
T |
 |
| Q |
335 |
caccggattgcc |
346 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
40416886 |
caccgggttgcc |
40416875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 256 - 346
Target Start/End: Original strand, 25632550 - 25632640
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc |
346 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||| | ||| ||||||| ||| |||||||| | ||||||||||||||||| ||||| |
|
|
| T |
25632550 |
aaaaacaggataaggctgcgtacaatacaccaaatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgcc |
25632640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 241 - 351
Target Start/End: Original strand, 27573646 - 27573756
Alignment:
| Q |
241 |
aacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
||||||||||||| || ||| | |||||||||||||||||||||||||||| | | ||| ||||| ||||| ||||||| ||||||||||||| ||| |
|
|
| T |
27573646 |
aacagcctcttgtgtataaacatggtaaggctgcgtacaatacaccaaatggtggaaccatttcccaaaccctgtgtatgtgggagctttagtgcatcgg |
27573745 |
T |
 |
| Q |
341 |
attgccttttt |
351 |
Q |
| |
|
||||| |||| |
|
|
| T |
27573746 |
gttgccctttt |
27573756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 148 - 236
Target Start/End: Original strand, 10543650 - 10543739
Alignment:
| Q |
148 |
ataaggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
||||||||||||||| || |||| |||||||||||||| |||||| || | ||| |||||||| |||||||||||| | ||||||||||| |
|
|
| T |
10543650 |
ataaggggtaaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacggcctcttgtgtaa |
10543739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 239 - 339
Target Start/End: Complemental strand, 21377185 - 21377085
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac |
337 |
Q |
| |
|
|||||| |||||||| |||||| |||||||||||| ||||||| ||||||||| | ||||| ||||||| ||||| |||||||| ||||||| |||||| |
|
|
| T |
21377185 |
gaaacatcctcttgtgtaaaaaacagggtaaggctgggtacaatgcaccaaatggtgggaccccttcccgaaccctgcgtatgtgggagcttt-gtgcac |
21377087 |
T |
 |
| Q |
338 |
cg |
339 |
Q |
| |
|
|| |
|
|
| T |
21377086 |
cg |
21377085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 249 - 349
Target Start/End: Complemental strand, 39499331 - 39499231
Alignment:
| Q |
249 |
cttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcctt |
348 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||| | ||| | ||| || | ||| |||||| | ||||||||||||||| ||||| ||| |
|
|
| T |
39499331 |
cttgtataaaaatagggtaaagctgcgtacaatacatcaaatggtgggatcccttttcgaatcctgcgtatgcgggagctttagtgcaccagattgtctt |
39499232 |
T |
 |
| Q |
349 |
t |
349 |
Q |
| |
|
| |
|
|
| T |
39499231 |
t |
39499231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 237 - 343
Target Start/End: Complemental strand, 19977828 - 19977721
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||| | |||||| |||| ||||| |||||||||||||||||||| | ||| | ||||||| ||| | ||||| | |||||||||||| |
|
|
| T |
19977828 |
tggaaacagcctcttttgtaaaaaataggataaggttgcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttagtgc |
19977729 |
T |
 |
| Q |
336 |
accggatt |
343 |
Q |
| |
|
||| |||| |
|
|
| T |
19977728 |
accagatt |
19977721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 12024098 - 12024012
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
12024098 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
12024012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 239 - 352
Target Start/End: Original strand, 5841051 - 5841167
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||||| |||| ||||| ||||||||||| ||||||||||||| || |||| | ||||| |||||||||||| | |||| | |||||||||||| |
|
|
| T |
5841051 |
gaaacagccttttgtgtaaaaaatagggtaaggatgcgtacaatacatcaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgc |
5841150 |
T |
 |
| Q |
336 |
accggattgccttttta |
352 |
Q |
| |
|
|||| ||||| ||||| |
|
|
| T |
5841151 |
accgagttgccctttta |
5841167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 152 - 236
Target Start/End: Original strand, 11514392 - 11514477
Alignment:
| Q |
152 |
ggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| | |||||||||||| ||||||||||| |
|
|
| T |
11514392 |
ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaactcctggaaacagcctcttgtgtaa |
11514477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 264 - 337
Target Start/End: Original strand, 24890460 - 24890533
Alignment:
| Q |
264 |
ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac |
337 |
Q |
| |
|
||||||||||| ||||||||||||| || | ||||| ||||||||||||| |||||| |||||||||||||| |
|
|
| T |
24890460 |
ggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac |
24890533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 238 - 330
Target Start/End: Complemental strand, 32781401 - 32781308
Alignment:
| Q |
238 |
ggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttt |
330 |
Q |
| |
|
||||||| |||||||| |||||| |||||||| ||||||||||||||||||||| | ||||| |||||| |||||| ||||| | ||||||| |
|
|
| T |
32781401 |
ggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccagaccctgtgtatgcgggagcttt |
32781308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 256 - 340
Target Start/End: Original strand, 44643564 - 44643648
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
||||| || ||||||||||||||||| |||||||| | ||||| |||||| |||||| |||||| | |||| |||||||||||| |
|
|
| T |
44643564 |
aaaaacagagtaaggctgcgtacaatgtaccaaatggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgg |
44643648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 239 - 334
Target Start/End: Complemental strand, 99375 - 99281
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
|||||||||||||||| ||||| | || ||||||||||||||||||||||||| | | ||| |||| | |||||| ||||| | ||||||||||| |
|
|
| T |
99375 |
gaaacagcctcttgta-aaaaacatggcaaggctgcgtacaatacaccaaatggtggaaccccttctcagaccctgtgtatgcgggagctttagtg |
99281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 17380350 - 17380248
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||| |||||||| || ||| ||||||||| || || |||||||||||||||| | ||| ||||| ||||||| || ||| | ||||||| ||||| |
|
|
| T |
17380350 |
tggaaacaacctcttgtgtataaacagggtaaggttgtgtgcaatacaccaaatgatggaaccccttcctggaccctgcggatgcgggagcttt-gtgca |
17380252 |
T |
 |
| Q |
337 |
ccgg |
340 |
Q |
| |
|
|||| |
|
|
| T |
17380251 |
ccgg |
17380248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 237 - 316
Target Start/End: Original strand, 5450306 - 5450387
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatag--ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacg |
316 |
Q |
| |
|
|||||||| |||||||| |||||| | |||||||||||||||||||||||||| | | ||||| ||||| |||||||||| |
|
|
| T |
5450306 |
tggaaacaacctcttgtgtaaaaaaacatggtaaggctgcgtacaatacaccaaagggtgggaccccttcctggaccctacg |
5450387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 7214489 - 7214575
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
||||||||| || ||||||| | |||||||||||| |||||| || | ||| | |||||| |||| ||||||||||||||||||||| |
|
|
| T |
7214489 |
aggggtaactttggcacaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaa |
7214575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 7214555 - 7214672
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacac--caaatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||| ||||||| ||||| | |||||||||||||||||||||||| ||||| | || | |||| ||||| || |||||| ||||| |||||| |
|
|
| T |
7214555 |
tggaaacagtctcttgtgtaaaatacagggtaaggctgcgtacaatacacaaaaaatggtgagatcccttctcggacactgcgtatgcgagagttttagt |
7214654 |
T |
 |
| Q |
334 |
gcaccggattgccttttt |
351 |
Q |
| |
|
||||| | |||||||||| |
|
|
| T |
7214655 |
gcaccaggttgccttttt |
7214672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 232
Target Start/End: Original strand, 14530273 - 14530355
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgt |
232 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
14530273 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt |
14530355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 295 - 345
Target Start/End: Original strand, 23488563 - 23488613
Alignment:
| Q |
295 |
ggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgc |
345 |
Q |
| |
|
||||| ||||||||||||| |||||| ||||||||||||||||||| |||| |
|
|
| T |
23488563 |
ggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgc |
23488613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 256 - 338
Target Start/End: Complemental strand, 31821437 - 31821355
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| ||||| ||| ||| | ||| ||||| | |||||||| |||||| |
|
|
| T |
31821437 |
aaaaatagggtaaggttgtgtacaatacaccaaatgatgggacccctttccgaaacctgtgtatgcgggagctttaatgcacc |
31821355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 237 - 352
Target Start/End: Complemental strand, 39914420 - 39914304
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
|||||||| |||||||| |||||| | |||||||| || |||||||||||| |||| | ||||| ||| || |||||| |||||| | ||||||||||| |
|
|
| T |
39914420 |
tggaaacaacctcttgtgtaaaaaaacagggtaaggatgtgtacaatacaccgaatggtgggacccctt-cctgaccctgcgtatgcgggagctttagtg |
39914322 |
T |
 |
| Q |
335 |
caccggattgccttttta |
352 |
Q |
| |
|
|| ||| ||||| ||||| |
|
|
| T |
39914321 |
catcgggttgccctttta |
39914304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 302 - 350
Target Start/End: Complemental strand, 124962 - 124914
Alignment:
| Q |
302 |
ttcccggaccctacgtatgtgagagctttagtgcaccggattgcctttt |
350 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||||||| ||||||||| |
|
|
| T |
124962 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcctttt |
124914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 239 - 351
Target Start/End: Original strand, 19615015 - 19615129
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgata--ggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||||||||| ||| ||| ||| ||||| ||||||| ||||| |||||| |||||||||||| |
|
|
| T |
19615015 |
gaaacatcctcttgtataaaaaacagggtaagactgcgtacaatatacc-aataatagtggaccccttcccgaaccctgcgtatgcaggagctttagtgc |
19615113 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
||| ||| ||||||| |
|
|
| T |
19615114 |
accatattaccttttt |
19615129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 240 - 338
Target Start/End: Complemental strand, 44449495 - 44449395
Alignment:
| Q |
240 |
aaacagcctcttgtat-aaaaatagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac |
337 |
Q |
| |
|
||||| ||||||| || ||||| ||| ||||||||||||||||||||| |||| | ||||| ||||||||||||| ||| |||| ||| |||| ||||| |
|
|
| T |
44449495 |
aaacaacctcttgaatgaaaaacaggataaggctgcgtacaatacaccaaaatagtgggaccccttcccggaccctgcgtttgtgggagttttaatgcac |
44449396 |
T |
 |
| Q |
338 |
c |
338 |
Q |
| |
|
| |
|
|
| T |
44449395 |
c |
44449395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 295 - 338
Target Start/End: Original strand, 8575975 - 8576018
Alignment:
| Q |
295 |
ggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
8575975 |
ggaccccttcccggaccctgcgtatgtgggagctttagtgcacc |
8576018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 338
Target Start/End: Original strand, 14544084 - 14544189
Alignment:
| Q |
237 |
tggaaacagcctcttgtata--aaaatagggtaaggctgcgtacaata--caccaaatgataggacctcttcccggaccctacgtatgtgagagctttag |
332 |
Q |
| |
|
||||||||||||||||| || |||| |||||||| |||||| ||||| || ||||| | ||||| ||||| ||||||| |||||| | ||||||||| |
|
|
| T |
14544084 |
tggaaacagcctcttgtgtagaaaaacagggtaagactgcgtgcaataaccaaaaaatggtcggaccccttccgggaccctgcgtatgcgggagctttag |
14544183 |
T |
 |
| Q |
333 |
tgcacc |
338 |
Q |
| |
|
|||||| |
|
|
| T |
14544184 |
tgcacc |
14544189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 302 - 353
Target Start/End: Original strand, 22371199 - 22371250
Alignment:
| Q |
302 |
ttcccggaccctacgtatgtgagagctttagtgcaccggattgcctttttat |
353 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||||||| ||||| |||||| |
|
|
| T |
22371199 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttat |
22371250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 153 - 235
Target Start/End: Complemental strand, 25249915 - 25249832
Alignment:
| Q |
153 |
gggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgta |
235 |
Q |
| |
|
|||||||||| || ||| | |||||||||||| |||||| || | ||| ||||||||| ||| |||||||||||||||||||| |
|
|
| T |
25249915 |
gggtaaccttggcgcaattggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatggaaacagtctcttgtgta |
25249832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 5840983 - 5841069
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| | ||| |||||||||||||| |||||| |||| ||| |||||||| |||||| ||||||| || |||||||| |
|
|
| T |
5840983 |
aggggtaaccttggtgcaaatgataaagttgttgtcatgtgactggaaggtcacgggttcaagtcctagaaacagccttttgtgtaa |
5841069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 239 - 341
Target Start/End: Original strand, 17471571 - 17471676
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||| |||||| | || |||| |||||||||||| ||| ||||||| |||| |||||| |||||| | |||| | ||| |||||||| |
|
|
| T |
17471571 |
gaaacagcctcttgtgtaaaaaaacaggataagactgcgtacaatataccaaaatgatgagaccccttccctgaccctgcctatgcgggagttttagtgc |
17471670 |
T |
 |
| Q |
336 |
accgga |
341 |
Q |
| |
|
|||||| |
|
|
| T |
17471671 |
accgga |
17471676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 17705450 - 17705536
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| | |||| | |||||||||||| |||||| | || ||| |||||||| |||||||||||| | ||||||||||| |
|
|
| T |
17705450 |
aggggtaaccttggtgcaactggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaaccgcctcttgtgtaa |
17705536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 21779439 - 21779353
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | | |||||||||| |||||| || | ||| |||||||| ||||||||| |||| ||||||||||| |
|
|
| T |
21779439 |
aggggtaaccttggcgcaactggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggagacagcctcttgtgtaa |
21779353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 224
Target Start/End: Original strand, 22371012 - 22371086
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacag |
224 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| ||| ||| |||||||| |||||||||||||| |
|
|
| T |
22371012 |
aggggtaaccttggcccaactggtaaagttgttgtcatgtgactgggaggtcacgggttcaagtcctggaaacag |
22371086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 23397721 - 23397807
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| | |||| | |||||||||||| |||||| || | ||| | ||||||| ||||||||||||| ||||||||||| |
|
|
| T |
23397721 |
aggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaa |
23397807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 23145809 - 23145736
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccc |
312 |
Q |
| |
|
|||||| ||||||| |||||| || |||||||||||||||||||||||| || | ||||| ||||||||||| |
|
|
| T |
23145809 |
aaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaattggtgggaccctttcccggaccc |
23145736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 23557599 - 23557526
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccc |
312 |
Q |
| |
|
|||||| ||||||| |||||| || |||||||||||||||||||||||| || | ||||| ||||||||||| |
|
|
| T |
23557599 |
aaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaattggtgggaccctttcccggaccc |
23557526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 151 - 211
Target Start/End: Complemental strand, 8455496 - 8455436
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca |
211 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| |||| ||| ||||||||| |
|
|
| T |
8455496 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttca |
8455436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 238 - 289
Target Start/End: Complemental strand, 15296520 - 15296468
Alignment:
| Q |
238 |
ggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaa |
289 |
Q |
| |
|
||||||||||| |||| ||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
15296520 |
ggaaacagcctgttgtgtaaaatacagggtaaggctgcgtacaatataccaaa |
15296468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 165 - 236
Target Start/End: Original strand, 17667971 - 17668043
Alignment:
| Q |
165 |
cacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||| | |||||||||||| |||||| |||| ||| |||||||| ||||||||||| | ||||||||||| |
|
|
| T |
17667971 |
cacaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaagaacctcttgtgtaa |
17668043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 151 - 211
Target Start/End: Complemental strand, 25079898 - 25079838
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca |
211 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| |||| ||| ||||||||| |
|
|
| T |
25079898 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttca |
25079838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 66; Significance: 6e-29; HSPs: 64)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 45071286 - 45071395
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||| | |||||| | |||||| |||||| |
|
|
| T |
45071286 |
tggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgca |
45071385 |
T |
 |
| Q |
337 |
ccggattgcc |
346 |
Q |
| |
|
|||| ||||| |
|
|
| T |
45071386 |
ccgggttgcc |
45071395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 239 - 346
Target Start/End: Original strand, 13160725 - 13160832
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | |||||| ||||| || |
|
|
| T |
13160725 |
gaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgcc |
13160824 |
T |
 |
| Q |
339 |
ggattgcc |
346 |
Q |
| |
|
|| ||||| |
|
|
| T |
13160825 |
gggttgcc |
13160832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 18164873 - 18164759
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| |||||||||||||||||| ||| |||| |||||||||||| |||||| | ||||||||||||| |
|
|
| T |
18164873 |
tggaaacagcctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaaggatgtgaccatttcccggaccctgcgtatgcgggagctttagtgca |
18164774 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
18164773 |
ccgggttgccatttt |
18164759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 237 - 353
Target Start/End: Original strand, 36720817 - 36720934
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | ||||||||||| |
|
|
| T |
36720817 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgc |
36720916 |
T |
 |
| Q |
336 |
accggattgcctttttat |
353 |
Q |
| |
|
||| | ||||| |||||| |
|
|
| T |
36720917 |
acccggttgcccttttat |
36720934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 28817740 - 28817625
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||||| |||| | ||||| ||||||||||||| |||||| | |||||||||||| |
|
|
| T |
28817740 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacccaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgc |
28817641 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
| ||| ||||| |||| |
|
|
| T |
28817640 |
atcgggttgccctttt |
28817625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 240 - 354
Target Start/End: Original strand, 31457197 - 31457311
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg |
339 |
Q |
| |
|
||||| |||||||| |||||||||| |||||||||||||||||| |||||| ||||||| |||||| ||||| |||||| | ||||| |||||||||| |
|
|
| T |
31457197 |
aaacaacctcttgtgtaaaaataggaaaaggctgcgtacaatacatcaaatggtaggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccg |
31457296 |
T |
 |
| Q |
340 |
gattgcctttttata |
354 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
31457297 |
gattgcccttttata |
31457311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 237 - 353
Target Start/End: Original strand, 44530170 - 44530287
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||| |||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||| ||||||| |||||| | |||||||||||| |
|
|
| T |
44530170 |
tggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgc |
44530269 |
T |
 |
| Q |
336 |
accggattgcctttttat |
353 |
Q |
| |
|
||||| ||| | |||||| |
|
|
| T |
44530270 |
accgggttgaccttttat |
44530287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 256 - 351
Target Start/End: Original strand, 389686 - 389781
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||| ||| | ||| || |||||| |||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
389686 |
aaaaacagggtaaggttgcgtacaatacaccaaatgatgggatccctttcctgaccctgcgtatgcgagagctttagtgcaccggattaccttttt |
389781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 12670362 - 12670260
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
12670362 |
tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
12670264 |
T |
 |
| Q |
337 |
ccgg |
340 |
Q |
| |
|
|||| |
|
|
| T |
12670263 |
ccgg |
12670260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 35261700 - 35261815
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||| ||||||| |||||| ||||||||| |||||||||||||||||||| | ||||| ||||| ||||||| |||||| | |||||||||||| |
|
|
| T |
35261700 |
tggaaacagtctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgc |
35261799 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
||||| ||||| |||| |
|
|
| T |
35261800 |
accgggttgccctttt |
35261815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 338
Target Start/End: Original strand, 29877115 - 29877217
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | |||| ||||||| |
|
|
| T |
29877115 |
tggaaacagccttttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcgttagtgc |
29877214 |
T |
 |
| Q |
336 |
acc |
338 |
Q |
| |
|
||| |
|
|
| T |
29877215 |
acc |
29877217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 355
Target Start/End: Complemental strand, 39461110 - 39460989
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| |||||| || |||||||||||||||||||||||| ||| | |||| ||||||||||||| |||||| | |||||||||| |
|
|
| T |
39461110 |
tggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttagt |
39461011 |
T |
 |
| Q |
334 |
gcaccggattgcctttttatat |
355 |
Q |
| |
|
||||||| ||||| |||||||| |
|
|
| T |
39461010 |
gcaccgggttgcccttttatat |
39460989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 237 - 345
Target Start/End: Complemental strand, 29521799 - 29521690
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||| | | |||| |||||| |||||| | |||||||||||| |
|
|
| T |
29521799 |
tggaaacagcctcttgtttaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaacccatcccagaccctgcgtatgcgggagctttagtgc |
29521700 |
T |
 |
| Q |
336 |
accggattgc |
345 |
Q |
| |
|
||||| |||| |
|
|
| T |
29521699 |
accgggttgc |
29521690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 20284187 - 20284079
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaata---gggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagcttta |
331 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||| |||| | ||||| ||||||||||||| |||||| | ||| |||| |
|
|
| T |
20284187 |
tggaaacagcctcttgtataaaaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagtttta |
20284088 |
T |
 |
| Q |
332 |
gtgcaccgg |
340 |
Q |
| |
|
||||||||| |
|
|
| T |
20284087 |
gtgcaccgg |
20284079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 239 - 339
Target Start/End: Complemental strand, 24365172 - 24365071
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaat--agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||| ||||||||||||||| | ||||| ||||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
24365172 |
gaaacagcctcttgtgtaaaaaatcagggtaaggctgcgaacaatacaccaaatggtgggaccccttcccggaccctgcgtatgtgggagcttt-gtgca |
24365074 |
T |
 |
| Q |
337 |
ccg |
339 |
Q |
| |
|
||| |
|
|
| T |
24365073 |
ccg |
24365071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 244 - 345
Target Start/End: Original strand, 5689659 - 5689761
Alignment:
| Q |
244 |
agcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggat |
342 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||||||| | | ||| ||||||| ||| | |||||||| ||||||||||||||||| | |
|
|
| T |
5689659 |
agcctcttgtgtaaaaagcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaaccatgcgtatgtgggagctttagtgcaccggtt |
5689758 |
T |
 |
| Q |
343 |
tgc |
345 |
Q |
| |
|
||| |
|
|
| T |
5689759 |
tgc |
5689761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 237 - 352
Target Start/End: Original strand, 12625910 - 12626027
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
|||||||| |||||||| |||||| | ||||||| |||| |||||||||||||||| | ||||| | ||||||||||| |||||| | ||||||||||| |
|
|
| T |
12625910 |
tggaaacaacctcttgtgtaaaaaaacagggtaagactgcatacaatacaccaaatggtgggaccccctcccggaccctgcgtatgcgggagctttagtg |
12626009 |
T |
 |
| Q |
335 |
caccggattgccttttta |
352 |
Q |
| |
|
|||||| ||||| ||||| |
|
|
| T |
12626010 |
caccgggttgccctttta |
12626027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 30454209 - 30454096
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| ||| ||||||||||||| |||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
30454209 |
tggaaacagcctcttgtgtaaaacaagg-taaggctgcgtacgatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
30454111 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
30454110 |
ccgggttgccctttt |
30454096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 21070816 - 21070707
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaata----gggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagcttt |
330 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||| |||| | ||||| ||||||||||||| |||||| | ||| ||| |
|
|
| T |
21070816 |
tggaaacagcctcttgtataaaaaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagtttt |
21070717 |
T |
 |
| Q |
331 |
agtgcaccgg |
340 |
Q |
| |
|
|||||||||| |
|
|
| T |
21070716 |
agtgcaccgg |
21070707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 2626540 - 2626653
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaata----gggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttag |
332 |
Q |
| |
|
||||||||||||||||| |||||| | ||||||| ||||||||||||||||||||||| ||||| |||||| |||||| | |||| | |||||| || |
|
|
| T |
2626540 |
tggaaacagcctcttgtgtaaaaaaaaacagggtaagactgcgtacaatacaccaaatgatgggaccccttcccagaccctgcatatgcgggagcttcag |
2626639 |
T |
 |
| Q |
333 |
tgcaccggattgcc |
346 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
2626640 |
tgcaccagattgcc |
2626653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 320
Target Start/End: Complemental strand, 5135403 - 5135319
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatg |
320 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||| ||||||||||||||||| | ||||| ||||||||||||| |||||| |
|
|
| T |
5135403 |
tggaaacagcctcttgtgtaaaaaagagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatg |
5135319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 256 - 351
Target Start/End: Complemental strand, 8897858 - 8897763
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| | ||||| ||||||||||||| | |||| | |||||||| |||||| | ||||| |||| |
|
|
| T |
8897858 |
aaaaatagggtaaggctacgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttactgcacccggttgccctttt |
8897763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 251 - 351
Target Start/End: Original strand, 10857865 - 10857965
Alignment:
| Q |
251 |
tgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcctttt |
350 |
Q |
| |
|
|||| ||||| |||||||||||||| |||||||||||| || | ||||| ||||| ||||| | |||||| | ||||||||||||||||| ||||| ||| |
|
|
| T |
10857865 |
tgtaaaaaaacagggtaaggctgcgcacaatacaccaattggtgggaccacttcctggaccttgcgtatgcgggagctttagtgcaccgggttgcccttt |
10857964 |
T |
 |
| Q |
351 |
t |
351 |
Q |
| |
|
| |
|
|
| T |
10857965 |
t |
10857965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 257 - 353
Target Start/End: Original strand, 19729382 - 19729478
Alignment:
| Q |
257 |
aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcctttttat |
353 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||| | ||||| ||||||||||||| | ||| | ||||| |||||||| |||||||| |||||| |
|
|
| T |
19729382 |
aaaacagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatacgggagctctagtgcactggattgcccttttat |
19729478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 7136643 - 7136537
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
|||||||| |||||||| |||||| |||||||||||||||||||||||||| |||| | ||||| |||||||||||| | |||| | |||||||||| |
|
|
| T |
7136643 |
tggaaacaacctcttgtgtaaaaaccagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagt |
7136544 |
T |
 |
| Q |
334 |
gcaccgg |
340 |
Q |
| |
|
||||||| |
|
|
| T |
7136543 |
gcaccgg |
7136537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 6760843 - 6760960
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||| |||||||||||||| |||| | ||||| |||| ||||||| | |||| | |||||||||| |
|
|
| T |
6760843 |
tggaaacagcctcttgtgtaaaaaacagggtaaggcttcgtacaatacaccaataatggtgggaccccttctcggaccccgcatatgcgggagctttagt |
6760942 |
T |
 |
| Q |
334 |
gcaccggattgccttttt |
351 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
6760943 |
gcaccgggttgccctttt |
6760960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 20869944 - 20870061
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||| ||||||| |||||| |||||||||||||||||||||||||| |||| | ||||| ||||| |||||| | |||| | |||||||||| |
|
|
| T |
20869944 |
tggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagctttagt |
20870043 |
T |
 |
| Q |
334 |
gcaccggattgccttttt |
351 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
20870044 |
gcaccgggttgccctttt |
20870061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 35261634 - 35261720
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| || ||||||||||||||||||||||| |
|
|
| T |
35261634 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagccctggaaacagtctcttgtgtaa |
35261720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 8484052 - 8483948
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||| |||||||| |||||| |||| |||||||||||||||||||||| || | ||||| | |||| |||||| |||||| | ||||||||| || |
|
|
| T |
8484052 |
tggaaacaacctcttgtgtaaaaaacagggcaaggctgcgtacaatacaccaattggtgggaccccatcccagaccctgcgtatgcgggagctttagggc |
8483953 |
T |
 |
| Q |
336 |
accgg |
340 |
Q |
| |
|
||||| |
|
|
| T |
8483952 |
accgg |
8483948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 12670428 - 12670342
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
12670428 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
12670342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 17823597 - 17823707
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||||| |||||| ||| |||| ||||||| ||||||||||||| | | ||| ||||||| ||||| | |||| |||||||||||| |
|
|
| T |
17823597 |
tggaaacagcctcttgtgtaaaaaccaggataagactgcgtaaaatacaccaaatggtggaaccccttcccgaaccctgcatatgcaggagctttagtgc |
17823696 |
T |
 |
| Q |
336 |
accggattgcc |
346 |
Q |
| |
|
||||| ||||| |
|
|
| T |
17823697 |
accgggttgcc |
17823707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 25250543 - 25250660
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||| ||||||||||||||||||| |||| | ||||| ||||||| |||| | |||| | ||| |||||| |
|
|
| T |
25250543 |
tggaaacagcctattgtgtaaaaaatagggtatggctgcgtacaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagatttagt |
25250642 |
T |
 |
| Q |
334 |
gcaccggattgccttttt |
351 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
25250643 |
gcaccgggttgccctttt |
25250660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 232
Target Start/End: Complemental strand, 29521865 - 29521783
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgt |
232 |
Q |
| |
|
|||||||||||| || |||| |||||||||||||| ||||| |||| ||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
29521865 |
aggggtaaccttggcgcaactgataaagttgttgtcgtgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgt |
29521783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 30454275 - 30454189
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
30454275 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
30454189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 36720751 - 36720837
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || ||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
36720751 |
aggggtaaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
36720837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 259 - 351
Target Start/End: Original strand, 26457773 - 26457863
Alignment:
| Q |
259 |
aatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||| || | ||||| || || |||| | |||||| | ||||||||||||||||| || ||||||| |
|
|
| T |
26457773 |
aatagggtaaggctgcgtacaatacaccaattggtgggacccct--cctgaccttgcgtatgagggagctttagtgcaccgggtttccttttt |
26457863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 352
Target Start/End: Original strand, 26954153 - 26954272
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttag |
332 |
Q |
| |
|
||||||||||||||||| |||||| | ||||||||||||||||||||||||| |||| | ||||| |||||| |||| | |||| | ||||||||| |
|
|
| T |
26954153 |
tggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagacctcgcatatgcgggagctttag |
26954252 |
T |
 |
| Q |
333 |
tgcaccggattgccttttta |
352 |
Q |
| |
|
||||| || ||||| ||||| |
|
|
| T |
26954253 |
tgcactgggttgccctttta |
26954272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 256 - 340
Target Start/End: Complemental strand, 44742613 - 44742528
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||| | ||||| |||| |||||||||| ||| | |||| |||||||||||| |
|
|
| T |
44742613 |
aaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcttggaccctacggatgcgggagcattagtgcaccgg |
44742528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 237 - 309
Target Start/End: Complemental strand, 23000332 - 23000260
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccgga |
309 |
Q |
| |
|
||||||||||||||||| |||||| | ||||||| | | |||||||||||||||| | ||||| ||||||||| |
|
|
| T |
23000332 |
tggaaacagcctcttgtgtaaaaacacggtaaggttccatacaatacaccaaatggtgggaccccttcccgga |
23000260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 256 - 352
Target Start/End: Complemental strand, 40604999 - 40604904
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttta |
352 |
Q |
| |
|
|||||| || ||||| |||||||||||||| ||||||| ||| | ||||| |||||||||||| | |||||||||||||||| |||||| ||||| |
|
|
| T |
40604999 |
aaaaattggataaggttgcgtacaatacactaaatgat-ggatcccttccgaaaccctacgtatgcgggagctttagtgcaccgaattgccctttta |
40604904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 44781620 - 44781517
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacacc--aaatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
|||||||| |||||||| ||||| | |||||||||||| |||||||||||| ||||| | ||||| | |||| |||||| |||||| | |||||||||| |
|
|
| T |
44781620 |
tggaaacaacctcttgtgtaaaagacagggtaaggctgtgtacaatacaccaaaaatgttgggaccccgtcccagaccctgcgtatgcgggagctttagt |
44781521 |
T |
 |
| Q |
334 |
gcac |
337 |
Q |
| |
|
|||| |
|
|
| T |
44781520 |
gcac |
44781517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 276 - 351
Target Start/End: Original strand, 26102578 - 26102653
Alignment:
| Q |
276 |
tacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||||||| ||||| |||| |
|
|
| T |
26102578 |
tacaatacaccaaatggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgccctttt |
26102653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 236
Target Start/End: Original strand, 26954110 - 26954173
Alignment:
| Q |
174 |
taaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| |||||||| || ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
26954110 |
taaagttgttgtcatgtgattagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
26954173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 236
Target Start/End: Original strand, 28407394 - 28407457
Alignment:
| Q |
174 |
taaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| |||||| |||| ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
28407394 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
28407457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 283 - 346
Target Start/End: Original strand, 28407471 - 28407534
Alignment:
| Q |
283 |
caccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc |
346 |
Q |
| |
|
||||||||| | ||||| |||||||||||||||||||| | |||||||| |||||||| ||||| |
|
|
| T |
28407471 |
caccaaatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgcc |
28407534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 314
Target Start/End: Original strand, 35105944 - 35106023
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacacca-aatgataggacctcttcccggacccta |
314 |
Q |
| |
|
|||||||| |||||||| ||||| | || ||||||||||||||||||||||| |||| | ||||||||||| |||||||| |
|
|
| T |
35105944 |
tggaaacaacctcttgtgtaaaagagagtgtaaggctgcgtacaatacaccagaatggtgggacctcttcctggacccta |
35106023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 7136709 - 7136623
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| |||| ||| | |||||| ||||||||||||| ||||||||||| |
|
|
| T |
7136709 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaa |
7136623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 20869676 - 20869590
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||| ||||||| || |||| | |||||||||||| |||||| || | ||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
20869676 |
agggataaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
20869590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 40605085 - 40604999
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
||||||||| || || |||| | |||||||||||| ||||||||||||| ||| |||||| |||| |||||||| ||| |||||||| |
|
|
| T |
40605085 |
aggggtaactttggcgcaactggtaaagttgttgtcatgtgattggatgattatgggttcaagtcatggaaacaatcttttgtgtaa |
40604999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 287 - 351
Target Start/End: Original strand, 18595910 - 18595974
Alignment:
| Q |
287 |
aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||| | ||| ||||||||| ||| |||||||||| |
|
|
| T |
18595910 |
aaatgataggaccccttcccggaccctgtgtatgcgggagttttagtgcatcgggttgccttttt |
18595974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 256 - 336
Target Start/End: Original strand, 36918165 - 36918245
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||| ||||| |||||| |||||| ||||| |||||||||| |||| |
|
|
| T |
36918165 |
aaaaacagggtaaggctgtgtacaatacaccaaatagtaggattccttcccaaaccctatgtatgcgagagctttaatgca |
36918245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 256 - 340
Target Start/End: Original strand, 16225060 - 16225146
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
||||| |||||||| ||||||||||||||||| |||| | ||| | |||||||||||| | |||| | ||||||||||||||||| |
|
|
| T |
16225060 |
aaaaacagggtaagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcaccgg |
16225146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 288
Target Start/End: Complemental strand, 20869610 - 20869560
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaa |
288 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||| |||||||||||||| |
|
|
| T |
20869610 |
tggaaacagcctcttgtgtaaaac-agggtaaggctgtgtacaatacaccaa |
20869560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 154 - 236
Target Start/End: Original strand, 25250480 - 25250563
Alignment:
| Q |
154 |
ggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
||||||||| ||||||| | |||||||||||| |||||| |||| ||| || |||| |||||||||||||| || |||||||| |
|
|
| T |
25250480 |
ggtaaccttggcacaactggtaaagttgttgtcatgtgactggaaggtcacatgttcaagtcctggaaacagcctattgtgtaa |
25250563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 300 - 351
Target Start/End: Complemental strand, 27468142 - 27468091
Alignment:
| Q |
300 |
tcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
|||||||||||||| |||||| | ||||||||||||||||| ||||| |||| |
|
|
| T |
27468142 |
tcttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
27468091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Original strand, 45071243 - 45071306
Alignment:
| Q |
174 |
taaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| ||||||||| | ||| |||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
45071243 |
taaagttgttgtcatgtgattgtaaggtcacgggttcaagttctggaaacagcctcttgtgtaa |
45071306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 2626474 - 2626560
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || ||| | |||||||||||| |||||| | | ||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
2626474 |
aggggtaaccttggcgcaattggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
2626560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 17823531 - 17823617
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||| ||| || |||| | |||||||||||| |||||| | | ||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
17823531 |
aggggtaatcttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
17823617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 18164939 - 18164853
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||| ||| || |||| | | |||||||||| |||||| || | ||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
18164939 |
aggggtaatcttggcgcaaccggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
18164853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 259 - 293
Target Start/End: Original strand, 28873242 - 28873276
Alignment:
| Q |
259 |
aatagggtaaggctgcgtacaatacaccaaatgat |
293 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
28873242 |
aatagggtaaggttgcgtacaatacaccaaatgat |
28873276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 240 - 289
Target Start/End: Original strand, 43942348 - 43942398
Alignment:
| Q |
240 |
aaacagcctcttgtat-aaaaatagggtaaggctgcgtacaatacaccaaa |
289 |
Q |
| |
|
|||||||||||| | | ||||| |||||||||||||||||||||||||||| |
|
|
| T |
43942348 |
aaacagcctcttatgtcaaaaacagggtaaggctgcgtacaatacaccaaa |
43942398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 242 - 291
Target Start/End: Complemental strand, 23286432 - 23286384
Alignment:
| Q |
242 |
acagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatg |
291 |
Q |
| |
|
|||||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
23286432 |
acagcctcttgtgtaaaac-agggtaaagctgcgtacaatacaccaaatg |
23286384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 336
Target Start/End: Complemental strand, 42083813 - 42083712
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
|||||||||||| |||| |||||| | ||| ||||||||||||| || |||||| || | ||||| ||||||| ||||| ||| ||| ||||||||||| |
|
|
| T |
42083813 |
tggaaacagccttttgtgtaaaaaatggggcaaggctgcgtacagtataccaaaatggtgggaccccttcccgaaccctgtgtacgtgggagctttagtg |
42083714 |
T |
 |
| Q |
335 |
ca |
336 |
Q |
| |
|
|| |
|
|
| T |
42083713 |
ca |
42083712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 17250991 - 17250888
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||| ||||||||||| |||||| ||| |||||| ||||||||||||||| |||| | ||||| |||||| ||||| |||||| |||||||||| |
|
|
| T |
17250991 |
tggaagcagcctcttgtgtaaaaaacaggttaaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaaggagctttagt |
17250892 |
T |
 |
| Q |
334 |
gcac |
337 |
Q |
| |
|
|||| |
|
|
| T |
17250891 |
gcac |
17250888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 6e-29; HSPs: 69)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 22609809 - 22609918
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||| | |||||| | |||||| |||||| |
|
|
| T |
22609809 |
tggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgca |
22609908 |
T |
 |
| Q |
337 |
ccggattgcc |
346 |
Q |
| |
|
|||| ||||| |
|
|
| T |
22609909 |
ccgggttgcc |
22609918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 237 - 357
Target Start/End: Complemental strand, 40272926 - 40272805
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||| |||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | |||||||||||| |
|
|
| T |
40272926 |
tggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgc |
40272827 |
T |
 |
| Q |
336 |
accggattgcctttttatatga |
357 |
Q |
| |
|
||||| ||||| |||| ||||| |
|
|
| T |
40272826 |
accgggttgcccttttttatga |
40272805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 240 - 339
Target Start/End: Complemental strand, 6411932 - 6411833
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg |
339 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||| |||||| |||| | |||||| | |||||||||||||||| |
|
|
| T |
6411932 |
aaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcaccg |
6411833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 237 - 352
Target Start/End: Complemental strand, 29366836 - 29366718
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| | ||||| ||||||||||||| |||||||| |||||||||| |
|
|
| T |
29366836 |
tggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttagt |
29366737 |
T |
 |
| Q |
334 |
gcaccggattgccttttta |
352 |
Q |
| |
|
|||| || ||||| ||||| |
|
|
| T |
29366736 |
gcactgggttgccctttta |
29366718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 54484733 - 54484849
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatag--ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
||||||||||||||||| |||||| | |||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | ||||||||||| |
|
|
| T |
54484733 |
tggaaacagcctcttgtgtaaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg |
54484832 |
T |
 |
| Q |
335 |
caccggattgccttttt |
351 |
Q |
| |
|
|||||| ||||| |||| |
|
|
| T |
54484833 |
caccgggttgccctttt |
54484849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 237 - 353
Target Start/End: Complemental strand, 13628906 - 13628787
Alignment:
| Q |
237 |
tggaaacagcctcttgtataa-aaatagggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| ||| ||| ||||||||||||||||||||||||||| ||| | ||||| ||||||||||||| |||||| | |||||||||| |
|
|
| T |
13628906 |
tggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagt |
13628807 |
T |
 |
| Q |
334 |
gcaccggattgcctttttat |
353 |
Q |
| |
|
||||||| ||||| |||||| |
|
|
| T |
13628806 |
gcaccgggttgcccttttat |
13628787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 239 - 354
Target Start/End: Original strand, 16735486 - 16735601
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| |||||||||| || |||||| | ||||| ||||||| |
|
|
| T |
16735486 |
gaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcact |
16735585 |
T |
 |
| Q |
339 |
ggattgcctttttata |
354 |
Q |
| |
|
|| ||||| ||||||| |
|
|
| T |
16735586 |
gggttgcccttttata |
16735601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 26869750 - 26869864
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||||||||| || |||||| |||||||||||||||||||||||||||||| | ||||| ||| ||||||| | |||||| | ||||||| ||||| |
|
|
| T |
26869750 |
tggaaacagcctctggtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttgccggaccatgcgtatgcgggagctttggtgca |
26869849 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
26869850 |
ccgggttgccctttt |
26869864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 22123029 - 22122921
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||| ||||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| ||||||| ||||||| |
|
|
| T |
22123029 |
tggaaacagtctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgagagctctagtgca |
22122931 |
T |
 |
| Q |
337 |
ccggattgcc |
346 |
Q |
| |
|
|||| ||||| |
|
|
| T |
22122930 |
ccgggttgcc |
22122921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 243 - 351
Target Start/End: Original strand, 15797271 - 15797378
Alignment:
| Q |
243 |
cagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggat |
342 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||||| ||||| ||||||||||| | |
|
|
| T |
15797271 |
cagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggt |
15797369 |
T |
 |
| Q |
343 |
tgccttttt |
351 |
Q |
| |
|
|||| |||| |
|
|
| T |
15797370 |
tgccctttt |
15797378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 1217133 - 1217246
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
1217133 |
tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggcgggaccccttcccggaccctgcatatgcgggagctctagtgca |
1217231 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
1217232 |
ccgggttgccctttt |
1217246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 31592892 - 31593000
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | |||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
31592892 |
tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggactccttcccggaccctgcatatgcgggagctctagtgca |
31592990 |
T |
 |
| Q |
337 |
ccggattgcc |
346 |
Q |
| |
|
|||| ||||| |
|
|
| T |
31592991 |
ccgggttgcc |
31593000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 240 - 313
Target Start/End: Original strand, 47624088 - 47624161
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct |
313 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| |
|
|
| T |
47624088 |
aaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
47624161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 45948952 - 45948848
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||| |||||||| |||||| |||||||||||||| ||||||||||||| || | ||||| |||| |||||||| |||||| | |||||||||||| |
|
|
| T |
45948952 |
tggaaacaacctcttgtgtaaaaaatagggtaaggctgcatacaatacaccaattggtgggaccccttctcggaccctgcgtatgcgggagctttagtgc |
45948853 |
T |
 |
| Q |
336 |
accgg |
340 |
Q |
| |
|
||||| |
|
|
| T |
45948852 |
accgg |
45948848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 239 - 346
Target Start/End: Original strand, 39203561 - 39203667
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| |||||||||||||||||||| | ||||| ||||||||||| | | |||| | ||||||||||||||| |
|
|
| T |
39203561 |
gaaacagcctcttgtgtaaaac-agggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccttgcatatgcgggagctttagtgcacc |
39203659 |
T |
 |
| Q |
339 |
ggattgcc |
346 |
Q |
| |
|
|| ||||| |
|
|
| T |
39203660 |
gggttgcc |
39203667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 46421151 - 46421033
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagcttt-ag |
332 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||| |||| | ||||| ||||||||||||| |||||| | ||||||| || |
|
|
| T |
46421151 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttaag |
46421052 |
T |
 |
| Q |
333 |
tgcaccggattgccttttt |
351 |
Q |
| |
|
|||||||| ||||| |||| |
|
|
| T |
46421051 |
tgcaccggtttgccctttt |
46421033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 237 - 338
Target Start/End: Original strand, 26573170 - 26573272
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||| ||| |||||| ||||||||||||||||||||||||||| || | ||||| | ||||||||||| |||||| | |||||||||||| |
|
|
| T |
26573170 |
tggaaacagcctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaattggtgggaccccatcccggaccctgcgtatgcgtgagctttagtgc |
26573269 |
T |
 |
| Q |
336 |
acc |
338 |
Q |
| |
|
||| |
|
|
| T |
26573270 |
acc |
26573272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 34420758 - 34420656
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||| |||||||||| || | ||||| ||||||||||| | |||||||| ||||||||||| |
|
|
| T |
34420758 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtaccatacaccaaaatggtgggaccccttcccggaccttgcgtatgtgggagctttagtg |
34420659 |
T |
 |
| Q |
335 |
cac |
337 |
Q |
| |
|
||| |
|
|
| T |
34420658 |
cac |
34420656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 257 - 340
Target Start/End: Complemental strand, 34771457 - 34771374
Alignment:
| Q |
257 |
aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||||||| |
|
|
| T |
34771457 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
34771374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 13730718 - 13730601
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||| |||||||||||||| ||| | ||||| |||||||||||| | |||| | |||||||||| |
|
|
| T |
13730718 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagt |
13730619 |
T |
 |
| Q |
334 |
gcaccggattgccttttt |
351 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
13730618 |
gcaccgggttgccctttt |
13730601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 237 - 334
Target Start/End: Original strand, 33926126 - 33926224
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacacca-aatgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
|||||| |||||||||| |||||| |||||||||||| ||||||||||||| |||| | ||||| ||||| ||||||| | |||| ||||||||||||| |
|
|
| T |
33926126 |
tggaaatagcctcttgtgtaaaaacagggtaaggctgtgtacaatacaccataatggtgggaccccttcctggaccctgcatatgcgagagctttagtg |
33926224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 240 - 346
Target Start/End: Complemental strand, 45786327 - 45786218
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacc--aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||| ||||| | ||||| ||||||||||||| || ||| ||||||||||||| |
|
|
| T |
45786327 |
aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgca |
45786228 |
T |
 |
| Q |
337 |
ccggattgcc |
346 |
Q |
| |
|
|||| ||||| |
|
|
| T |
45786227 |
ccgggttgcc |
45786218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 49013589 - 49013472
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||| |||| | ||||| |||||||||||| | || | | |||||||||| |
|
|
| T |
49013589 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagt |
49013490 |
T |
 |
| Q |
334 |
gcaccggattgccttttt |
351 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
49013489 |
gcaccgggttgccctttt |
49013472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 265 - 351
Target Start/End: Complemental strand, 52926304 - 52926218
Alignment:
| Q |
265 |
gtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
||||||||||||||||||||||||||| | |||| ||||||||||||| |||||| | ||||||||| ||||||| ||||| |||| |
|
|
| T |
52926304 |
gtaaggctgcgtacaatacaccaaatggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctttt |
52926218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 338
Target Start/End: Complemental strand, 10795539 - 10795435
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacacc--aaatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| ||||| | ||||||||||||||||||||||||| ||||| | ||||| ||||| ||||||| |||||| | |||||| ||| |
|
|
| T |
10795539 |
tggaaacagcctcttgtgtaaaagacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagt |
10795440 |
T |
 |
| Q |
334 |
gcacc |
338 |
Q |
| |
|
||||| |
|
|
| T |
10795439 |
gcacc |
10795435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 53996680 - 53996575
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
|||||||| |||||||| |||||| ||||||||||||| |||||||||||||| || | ||||| |||||| ||| || |||||||| ||||||||||| |
|
|
| T |
53996680 |
tggaaacaacctcttgtgtaaaaaacagggtaaggctgcttacaatacaccaaaatggtgggaccccttccctgacactgcgtatgtgggagctttagtg |
53996581 |
T |
 |
| Q |
335 |
caccgg |
340 |
Q |
| |
|
|||||| |
|
|
| T |
53996580 |
caccgg |
53996575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 237 - 352
Target Start/End: Complemental strand, 12914149 - 12914033
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||| ||||||||||||||||||| | |||| |||||| |||||| | |||| | |||||| | ||| |
|
|
| T |
12914149 |
tggaaacagcctcttgtgtaaaaaacagggtaaggcggcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgcgggagcttcaatgc |
12914050 |
T |
 |
| Q |
336 |
accggattgccttttta |
352 |
Q |
| |
|
||||| ||||| ||||| |
|
|
| T |
12914049 |
accgggttgccctttta |
12914033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 14987000 - 14987106
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||| |||| | ||||| |||||||||| | | |||| | |||||||||| |
|
|
| T |
14987000 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcgggagctttagt |
14987099 |
T |
 |
| Q |
334 |
gcaccgg |
340 |
Q |
| |
|
||||||| |
|
|
| T |
14987100 |
gcaccgg |
14987106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 338
Target Start/End: Complemental strand, 54374460 - 54374357
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
|||||||| |||||||| |||||| ||||||||||||||||||||| |||| ||||| | ||||| ||||||||||||| | |||| | |||||||||| |
|
|
| T |
54374460 |
tggaaacaacctcttgtgtaaaaaatagggtaaggctgcgtacaatccaccaaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtt |
54374361 |
T |
 |
| Q |
335 |
cacc |
338 |
Q |
| |
|
|||| |
|
|
| T |
54374360 |
cacc |
54374357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 13730784 - 13730698
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
13730784 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
13730698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 256 - 346
Target Start/End: Complemental strand, 353445 - 353353
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc |
346 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||| | ||||| |||||||||||| | |||| | ||||||||||||||||| ||||| |
|
|
| T |
353445 |
aaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcc |
353353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 151 - 235
Target Start/End: Complemental strand, 52926390 - 52926305
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgta |
235 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||| |||||||||| |
|
|
| T |
52926390 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgta |
52926305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 516452 - 516570
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgatag---gacctcttcccggaccctacgtatgtgagagctttag |
332 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||| |||||| |||||| || | |||| |||||| |||||| |||||| | ||||||||| |
|
|
| T |
516452 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgcacaataaaccaaaaaatggcgggaccccttccccgaccctgcgtatgcgggagctttag |
516551 |
T |
 |
| Q |
333 |
tgcaccggattgccttttt |
351 |
Q |
| |
|
|||||||| ||||| |||| |
|
|
| T |
516552 |
tgcaccgggttgccctttt |
516570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 7943033 - 7943148
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||||| |||||| |||||| |||||||| |||||||||||||| |||||| | ||| | ||| || |||| | |||||| | |||||||||||| |
|
|
| T |
7943033 |
tggaaacagcatcttgtctaaaaaacagggtaagactgcgtacaatacatcaaatggtgggatccctttccagaccatgcgtatgcgggagctttagtgc |
7943132 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
|| || |||||||||| |
|
|
| T |
7943133 |
actgggttgccttttt |
7943148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 269 - 352
Target Start/End: Complemental strand, 25517251 - 25517168
Alignment:
| Q |
269 |
ggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttta |
352 |
Q |
| |
|
||||||||||||||||| ||||| | ||||| ||||||||| ||| |||||| ||||||||||||||||| ||||| ||||| |
|
|
| T |
25517251 |
ggctgcgtacaatacacaaaatggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgccctttta |
25517168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 7697065 - 7696979
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| | | ||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7697065 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagtctcttgtgtaa |
7696979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 237 - 331
Target Start/End: Complemental strand, 8247803 - 8247706
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagcttta |
331 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| |||||||||||||||| |||| | |||| ||||||||||||| |||||| | |||||||| |
|
|
| T |
8247803 |
tggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggactccttcccggaccctgcgtatgcgggagcttta |
8247706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 8247869 - 8247783
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
8247869 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
8247783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 243 - 320
Target Start/End: Original strand, 9276313 - 9276390
Alignment:
| Q |
243 |
cagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatg |
320 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| |||||||||||| |||||| |
|
|
| T |
9276313 |
cagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggt-ggaccctttcccggaccctgcgtatg |
9276390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 10870131 - 10870045
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
10870131 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
10870045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 237 - 291
Target Start/End: Original strand, 31831242 - 31831295
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatg |
291 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
31831242 |
tggaaacagcctcttgtgtaaaa-tagggtaaggctgcatacaatacaccaaatg |
31831295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 52428591 - 52428480
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgatag-------gacctcttcccggaccctacgtatgtgagagct |
328 |
Q |
| |
|
||||| ||||||||||| ||||| | ||||||||||||||||||||||||||||| | | ||| |||| ||||||||||||||||| ||||| |
|
|
| T |
52428591 |
tggaagcagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatagtggaaccccaaaccccttctcggaccctacgtatgtgggagct |
52428492 |
T |
 |
| Q |
329 |
ttagtgcaccgg |
340 |
Q |
| |
|
|||||||||||| |
|
|
| T |
52428491 |
ttagtgcaccgg |
52428480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 7696999 - 7696902
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||| ||||||| ||||| ||||||||||||||||||||||||||||| | || |||||||||| || | |||||| ||||| ||||||| |
|
|
| T |
7696999 |
tggaaacagtctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaat-----ggccccttcccggacactgcatatgtgggagctctagtgca |
7696906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 4495844 - 4495758
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
||||||||||||||| |||| | |||||||||||| |||||| |||| ||| |||||||| ||||||| ||| || || |||||||| |
|
|
| T |
4495844 |
aggggtaaccttcgcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctgaaaatagcctattgtgtaa |
4495758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 244 - 351
Target Start/End: Complemental strand, 44403663 - 44403554
Alignment:
| Q |
244 |
agcctcttgtataaaa-atagggtaaggctgcgtacaatac-accaaatgataggacctcttcccggaccctacgtatg-tgagagctttagtgcaccgg |
340 |
Q |
| |
|
|||||||||| ||||| | | |||||||||||| | ||||| || ||||| | ||||| |||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
44403663 |
agcctcttgtgtaaaagacaaggtaaggctgcggagaataccacaaaatggtgggaccccttcccggaccctacgtatgctga-agctttagtgcaccgg |
44403565 |
T |
 |
| Q |
341 |
attgccttttt |
351 |
Q |
| |
|
||||||||| |
|
|
| T |
44403564 |
gctgccttttt |
44403554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 237 - 288
Target Start/End: Complemental strand, 45620943 - 45620890
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacaccaa |
288 |
Q |
| |
|
||||||||||||||||| |||||| | |||||||||||||||||||||||||| |
|
|
| T |
45620943 |
tggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaa |
45620890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 46421217 - 46421131
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| | | ||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
46421217 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
46421131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 239 - 340
Target Start/End: Complemental strand, 50625065 - 50624963
Alignment:
| Q |
239 |
gaaacagcctcttgtata-aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac |
337 |
Q |
| |
|
||||||||||||||| || |||| ||||||||| ||||||||||||||| || | |||| ||||| || |||| |||| ||| |||||||||||||| |
|
|
| T |
50625065 |
gaaacagcctcttgtgtataaaaaagggtaaggtagcgtacaatacaccatttggtgggacgccttcctgggccctgcgtaagtgggagctttagtgcac |
50624966 |
T |
 |
| Q |
338 |
cgg |
340 |
Q |
| |
|
||| |
|
|
| T |
50624965 |
cgg |
50624963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 5173834 - 5173718
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
|||||||| |||||||| |||||| | |||||| ||| | |||||||||||| || | || || ||||||||||| | |||||| | ||||||||||| |
|
|
| T |
5173834 |
tggaaacaacctcttgtgtaaaaacaaagtaaggttgcatgcaatacaccaaaaatggtggggccccttcccggaccttgcgtatgcgggagctttagtg |
5173735 |
T |
 |
| Q |
335 |
caccggattgccttttt |
351 |
Q |
| |
|
|||||| ||||| |||| |
|
|
| T |
5173734 |
caccgggttgccctttt |
5173718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 349
Target Start/End: Complemental strand, 43114984 - 43114869
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaata--gggtaagg-ctgcgtacaatacaccaaatgataggacctcttcccggaccc-tacgtatgtgagagctttag |
332 |
Q |
| |
|
||||||||||||||||| |||||| | |||||||| || | |||||||||||||||| | ||||| ||||| |||||| | |||||| | ||||||||| |
|
|
| T |
43114984 |
tggaaacagcctcttgtgtaaaaaaacagggtaagggctacctacaatacaccaaatggtgggacc-cttcctggacccctgcgtatgcgggagctttag |
43114886 |
T |
 |
| Q |
333 |
tgcaccggattgccttt |
349 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
43114885 |
tgcattggattgccttt |
43114869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 293 - 353
Target Start/End: Complemental strand, 10484673 - 10484613
Alignment:
| Q |
293 |
taggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcctttttat |
353 |
Q |
| |
|
||||||| ||||| ||||||| |||||| | ||||||||||||||||| ||||| |||||| |
|
|
| T |
10484673 |
taggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttat |
10484613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 237 - 277
Target Start/End: Complemental strand, 10870065 - 10870025
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgta |
277 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
10870065 |
tggaaacagcctcttgtgtaaaaacagggtaaggctgcgta |
10870025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 267 - 338
Target Start/End: Original strand, 25944543 - 25944615
Alignment:
| Q |
267 |
aaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||||| |||||||||||| ||||| | ||||| |||||| |||||| |||||||| ||||||||| ||||| |
|
|
| T |
25944543 |
aaggctgagtacaatacaccaaaatggtgggaccccttccctgaccctgcgtatgtgggagctttagcgcacc |
25944615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 244 - 355
Target Start/End: Original strand, 26292382 - 26292493
Alignment:
| Q |
244 |
agcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggatt |
343 |
Q |
| |
|
|||||||||| ||||| |||||||| | |||||| |||||||||||||| ||| | ||||||| ||||| | |||| | || || ||||||||||| || |
|
|
| T |
26292382 |
agcctcttgtgtaaaac-agggtaagaccgcgtacgatacaccaaatgatgggatcccttcccgaaccctgcatatgcgggaactctagtgcaccgggtt |
26292480 |
T |
 |
| Q |
344 |
g-cctttttatat |
355 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
26292481 |
gtcctttttatat |
26292493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 256 - 291
Target Start/End: Complemental strand, 4495758 - 4495723
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaatg |
291 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4495758 |
aaaaacagggtaaggctgcgtacaatacaccaaatg |
4495723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 295 - 338
Target Start/End: Complemental strand, 45288110 - 45288067
Alignment:
| Q |
295 |
ggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
45288110 |
ggacctcttcccggaccctgcgtatgcaagagctttagtgcacc |
45288067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 1217067 - 1217153
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | ||||||||| || |||| | || | ||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
1217067 |
aggggtaaccttggcgcaactggtaaagttgtagtcatgtcactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
1217153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 285 - 351
Target Start/End: Original strand, 10300583 - 10300649
Alignment:
| Q |
285 |
ccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
||||||||| |||| |||||| ||||||||||||| | |||||||| || || ||||||||||||| |
|
|
| T |
10300583 |
ccaaatgatgggactccttcccagaccctacgtatgcgggagctttaatgtactggattgccttttt |
10300649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 237 - 330
Target Start/End: Complemental strand, 30928261 - 30928167
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttt |
330 |
Q |
| |
|
||||||||||||||||| |||||| | ||||||| || ||| |||||||||| || ||||| ||||||||||||| | |||||| ||||||| |
|
|
| T |
30928261 |
tggaaacagcctcttgtgtaaaaaacaaggtaaggttgtgtaaaatacaccaattggcgggaccccttcccggaccctgcatatgtgggagcttt |
30928167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 39203493 - 39203579
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| |||||| || | ||| || ||||| |||||| ||||||| ||||||||||| |
|
|
| T |
39203493 |
aggggtaaccttggcacaacttgtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtccttgaaacagcctcttgtgtaa |
39203579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 272 - 340
Target Start/End: Complemental strand, 829521 - 829452
Alignment:
| Q |
272 |
tgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
|||||||||||||||||| || | ||||| ||||||| ||||| |||||| ||||||||||||||||| |
|
|
| T |
829521 |
tgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcaccgg |
829452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 289
Target Start/End: Complemental strand, 45139592 - 45139539
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaa |
289 |
Q |
| |
|
|||||||| |||||||| ||||| | ||||||||||||| |||||||||||||| |
|
|
| T |
45139592 |
tggaaacaacctcttgtgtaaaacacagggtaaggctgcatacaatacaccaaa |
45139539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 279 - 336
Target Start/End: Complemental strand, 46170038 - 46169981
Alignment:
| Q |
279 |
aatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||| |||||||| ||||||| ||||||||||||| | |||||| |||||| |||||| |
|
|
| T |
46170038 |
aataaaccaaatggtaggaccccttcccggaccctgcatatgtgggagcttcagtgca |
46169981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 302 - 351
Target Start/End: Original strand, 47624208 - 47624257
Alignment:
| Q |
302 |
ttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||||||| ||||| |||| |
|
|
| T |
47624208 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
47624257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 313
Target Start/End: Complemental strand, 8410979 - 8410904
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct |
313 |
Q |
| |
|
||||||| ||||| |||| ||||| ||||||||||||| |||||||||||| || | |||||||||| | |||||| |
|
|
| T |
8410979 |
tggaaactgcctcgtgta-aaaaacagggtaaggctgctcacaatacaccaactggtgggacctcttctcagaccct |
8410904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 288
Target Start/End: Original strand, 9607246 - 9607298
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa |
288 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||| |||||||||| |
|
|
| T |
9607246 |
tggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtagaatacaccaa |
9607298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 290
Target Start/End: Original strand, 21875056 - 21875111
Alignment:
| Q |
237 |
tggaaacagcctcttgtat--aaaaatagggtaaggctgcgtacaatacaccaaat |
290 |
Q |
| |
|
|||||||| |||||||| | ||||| |||||||||||||||||||||||| |||| |
|
|
| T |
21875056 |
tggaaacaacctcttgtgttaaaaaagagggtaaggctgcgtacaatacactaaat |
21875111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 295 - 355
Target Start/End: Original strand, 30452897 - 30452957
Alignment:
| Q |
295 |
ggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcctttttatat |
355 |
Q |
| |
|
||||| ||||||||||||| | |||| | ||||| ||||||||||| ||||| |||||||| |
|
|
| T |
30452897 |
ggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttatat |
30452957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 240 - 350
Target Start/End: Original strand, 55401222 - 55401334
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac |
337 |
Q |
| |
|
|||||||||||||| |||||| ||| |||| ||||||| |||||||| ||||| | ||||| |||| |||||| | |||||| | ||||||| ||||| |
|
|
| T |
55401222 |
aaacagcctcttgtgtaaaaaacaggttaagactgcgtataatacaccaaaatggtgggaccccttctcggaccttccgtatgcgggagcttttttgcac |
55401321 |
T |
 |
| Q |
338 |
cggattgcctttt |
350 |
Q |
| |
|
||| |||||||| |
|
|
| T |
55401322 |
cgggctgcctttt |
55401334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 64; Significance: 9e-28; HSPs: 3)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 46852 - 46967
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||| |||||||| ||||| ||||||||||| |||||||||||||||||||| | ||||| ||||||||||||| |||||| | |||||||||||| |
|
|
| T |
46852 |
tggaaacaacctcttgtgtaaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgc |
46951 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
||||| ||||| |||| |
|
|
| T |
46952 |
accgggttgccctttt |
46967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 241 - 336
Target Start/End: Complemental strand, 24882 - 24786
Alignment:
| Q |
241 |
aacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||| |||||||||| | ||||| ||||||| ||||| |||||| | ||||||||||||| |
|
|
| T |
24882 |
aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaacacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
24786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 237 - 354
Target Start/End: Original strand, 43680 - 43797
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctc-ttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||||| |||||| ||||| ||| |||||||||||||||||||||||||| | ||||| | ||| |||||||| | |||| | ||||| |||||| |
|
|
| T |
43680 |
tggaaacagcgtcttgtgtaaaacaagg-taaggctgcgtacaatacaccaaatggtgggacccctttctcggaccctgcatatgcgggagctctagtgc |
43778 |
T |
 |
| Q |
336 |
accggattgcctttttata |
354 |
Q |
| |
|
|| | ||||| ||||||| |
|
|
| T |
43779 |
actgagttgcccttttata |
43797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 64; Significance: 9e-28; HSPs: 45)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 24448911 - 24449026
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| |||||||||||| |
|
|
| T |
24448911 |
tggaaacagccttttgtgtaaaaaatagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgc |
24449010 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
||||| ||||| |||| |
|
|
| T |
24449011 |
accgggttgccctttt |
24449026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 237 - 352
Target Start/End: Original strand, 38879602 - 38879720
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| | ||||| ||||||||||||| |||||| | |||||||||| |
|
|
| T |
38879602 |
tggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagt |
38879701 |
T |
 |
| Q |
334 |
gcaccggattgccttttta |
352 |
Q |
| |
|
||||||| ||||| ||||| |
|
|
| T |
38879702 |
gcaccgggttgccctttta |
38879720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 237 - 352
Target Start/End: Original strand, 41014340 - 41014455
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||| |||||| | |||| | ||||||||||||| |
|
|
| T |
41014340 |
tggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcctggaccccgcatatgcgggagctttagtgca |
41014439 |
T |
 |
| Q |
337 |
ccggattgccttttta |
352 |
Q |
| |
|
|||| ||||| ||||| |
|
|
| T |
41014440 |
ccgggttgccctttta |
41014455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 352
Target Start/End: Original strand, 32703445 - 32703559
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
32703445 |
tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
32703543 |
T |
 |
| Q |
337 |
ccggattgccttttta |
352 |
Q |
| |
|
|||| ||||| ||||| |
|
|
| T |
32703544 |
ccgggttgccctttta |
32703559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 7368419 - 7368527
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||| || | ||||| ||||||||||||| | |||||| ||||| ||||||| |
|
|
| T |
7368419 |
tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaattggtgggaccccttcccggaccctgcatatgtgggagctctagtgca |
7368517 |
T |
 |
| Q |
337 |
ccggattgcc |
346 |
Q |
| |
|
|||| ||||| |
|
|
| T |
7368518 |
ccgggttgcc |
7368527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 240 - 338
Target Start/End: Complemental strand, 7097870 - 7097772
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
|||||||||||||| |||||| ||||||||| |||||||||||||||||||| | |||| ||||||| ||||| |||||| | ||||||||||||||| |
|
|
| T |
7097870 |
aaacagcctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaatggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcacc |
7097772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 237 - 353
Target Start/End: Complemental strand, 4619220 - 4619101
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
|||||| |||||||||| |||||| ||||||||||||||||||||||||||| ||| | ||||| |||||||||||| | |||| |||||||||||| |
|
|
| T |
4619220 |
tggaaatagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagt |
4619121 |
T |
 |
| Q |
334 |
gcaccggattgcctttttat |
353 |
Q |
| |
|
||||||| ||||| |||||| |
|
|
| T |
4619120 |
gcaccgggttgcccttttat |
4619101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 241 - 340
Target Start/End: Complemental strand, 16880757 - 16880657
Alignment:
| Q |
241 |
aacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg |
339 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||||| | |||| ||||||||||| | |||||| | |||||||||||||||| |
|
|
| T |
16880757 |
aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccg |
16880658 |
T |
 |
| Q |
340 |
g |
340 |
Q |
| |
|
| |
|
|
| T |
16880657 |
g |
16880657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 19143056 - 19142956
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||| |||||||| |||||| |||||||||||||||||| ||||||||||| | ||||| ||||||||||| | |||||| | ||| ||||||||| |
|
|
| T |
19143056 |
tggaaacaacctcttgtgtaaaaacagggtaaggctgcgtacagtacaccaaatggtgggaccccttcccggaccatgcgtatgcgggagatttagtgca |
19142957 |
T |
 |
| Q |
337 |
c |
337 |
Q |
| |
|
| |
|
|
| T |
19142956 |
c |
19142956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 237 - 352
Target Start/End: Original strand, 27328773 - 27328891
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||| ||||||| |||||| ||||||||||||||||||||||||||| ||| | ||||| ||||||| ||||| |||||| | |||||||| | |
|
|
| T |
27328773 |
tggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccgaaccctgcgtatgcgggagctttaat |
27328872 |
T |
 |
| Q |
334 |
gcaccggattgccttttta |
352 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
27328873 |
gcatcggattgccttttta |
27328891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 8170096 - 8169983
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||| || |||||| |
|
|
| T |
8170096 |
tggaaacagccttttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagtttcagtgca |
8169998 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
8169997 |
ccgggttgccctttt |
8169983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 35710334 - 35710447
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||| |||||||||||||| | ||||| ||||||||| | | | |||| | ||||| ||||||| |
|
|
| T |
35710334 |
tggaaacagcctcttgtgtaaaa-tagggtaaggctgcgttcaatacaccaaatggtgggaccccttcccggaacatgcatatgcgggagctctagtgca |
35710432 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
35710433 |
ccgggttgccctttt |
35710447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 13801883 - 13801771
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||| ||||||||||| |||||| |||||||||||||||||||||||||| |||| | ||||| |||||||||||| | |||| |||||||||||| |
|
|
| T |
13801883 |
tggaagcagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagt |
13801784 |
T |
 |
| Q |
334 |
gcaccggattgcc |
346 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
13801783 |
gcaccgggttgcc |
13801771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 43574627 - 43574731
Alignment:
| Q |
237 |
tggaaacagcctcttgtata-aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||| ||||||| || |||| ||||||||||||||||||||| |||||||| | ||||| ||||||||||||| |||||| | ||||||||| || |
|
|
| T |
43574627 |
tggaaacaatctcttgtgtagaaaacagggtaaggctgcgtacaatataccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagagc |
43574726 |
T |
 |
| Q |
336 |
accgg |
340 |
Q |
| |
|
||||| |
|
|
| T |
43574727 |
accgg |
43574731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 239 - 320
Target Start/End: Original strand, 2838802 - 2838883
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatg |
320 |
Q |
| |
|
|||||||| |||||| |||||| |||||||||||||||||||||||||||||| | ||| | |||| |||||||| |||||| |
|
|
| T |
2838802 |
gaaacagcatcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggatcccttctcggaccctgcgtatg |
2838883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 275 - 352
Target Start/End: Original strand, 16957374 - 16957451
Alignment:
| Q |
275 |
gtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttta |
352 |
Q |
| |
|
||||||||||||||||| | ||||| ||||||||||||| |||||| | ||||||||||||||||| ||||| ||||| |
|
|
| T |
16957374 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
16957451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 29334416 - 29334521
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca-aatgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
||||||||||||||||| |||||| | |||||||||||||||||||||||| |||| | ||||| |||||||||||| |||||||| || ||||| || |
|
|
| T |
29334416 |
tggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccagaatggtgggacccattcccggaccctgcgtatgtgggatctttaatg |
29334515 |
T |
 |
| Q |
335 |
caccgg |
340 |
Q |
| |
|
|||||| |
|
|
| T |
29334516 |
caccgg |
29334521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 262 - 346
Target Start/End: Complemental strand, 34154902 - 34154818
Alignment:
| Q |
262 |
agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | |||| ||||||||||| ||||| |
|
|
| T |
34154902 |
agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcc |
34154818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 43334223 - 43334340
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacacc--aaatgataggacctcttcccggaccctacgtatgtgagagctttag |
332 |
Q |
| |
|
||||||||||||| ||| |||||| | |||||||||||||||||||||||| ||||| | ||||| ||||||||||||| || ||| | ||||||||| |
|
|
| T |
43334223 |
tggaaacagcctcctgtgtaaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcg-atgcgggagctttag |
43334321 |
T |
 |
| Q |
333 |
tgcaccggattgccttttt |
351 |
Q |
| |
|
|||||||| ||||| |||| |
|
|
| T |
43334322 |
tgcaccgggttgccctttt |
43334340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 336
Target Start/End: Complemental strand, 5873435 - 5873336
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||| |||||||| || | |||| || ||||||| || |||||| | ||||||||||||| |
|
|
| T |
5873435 |
tggaaacagcctcttgtgtaaaaatagggtaaggctaagtacactacaccaattggtgggactcctccccggacactgcgtatgcgggagctttagtgca |
5873336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 240 - 350
Target Start/End: Original strand, 30006349 - 30006460
Alignment:
| Q |
240 |
aaacagcctcttgtataaa-aatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||| |||||| |||||| || |||||||||||| ||||| ||||| ||||| | ||||| |||||||| |||| ||||| | ||||||||||||||| |
|
|
| T |
30006349 |
aaacaacctcttatataaacaacagggtaaggctgtgtacattacactaaatggtgggaccccttcccggggcctatgtatgcgggagctttagtgcacc |
30006448 |
T |
 |
| Q |
339 |
ggattgcctttt |
350 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
30006449 |
gggttgcctttt |
30006460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 41014274 - 41014360
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
41014274 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
41014360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 251 - 340
Target Start/End: Original strand, 3771375 - 3771464
Alignment:
| Q |
251 |
tgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
|||| ||||| |||||||||||| | |||||||||||| || | ||||| |||||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
3771375 |
tgtaaaaaaacagggtaaggctgtgaacaatacaccaattggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgg |
3771464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 241 - 340
Target Start/End: Complemental strand, 209037 - 208937
Alignment:
| Q |
241 |
aacagcctcttgtataaaaatagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg |
339 |
Q |
| |
|
|||| |||||||| |||||| ||||||||||||| | ||||||||| ||||| | ||||| ||||| ||||||| ||||| ||||||||||||||||| |
|
|
| T |
209037 |
aacaacctcttgtgtaaaaacagggtaaggctgcattcaatacaccaaaatggtgggaccccttcctggaccctgggtatgcaagagctttagtgcaccg |
208938 |
T |
 |
| Q |
340 |
g |
340 |
Q |
| |
|
| |
|
|
| T |
208937 |
g |
208937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 24448845 - 24448931
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||| || |||||||| |
|
|
| T |
24448845 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagccttttgtgtaa |
24448931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 246 - 343
Target Start/End: Original strand, 1850670 - 1850767
Alignment:
| Q |
246 |
cctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggatt |
343 |
Q |
| |
|
|||||||| |||||| || ||||| ||||||||||||| |||||| | ||||| ||||| ||||||| || ||| | ||||||||||||||||||| |
|
|
| T |
1850670 |
cctcttgtgtaaaaacagaataagggtgcgtacaatacatcaaatggtgggaccacttcctggaccctgcggatgcggaagctttagtgcaccggatt |
1850767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 20135625 - 20135737
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| |||||| | |||||||||||||||||||||||| |||| | ||||| |||||||||||| | |||| |||||| ||| |
|
|
| T |
20135625 |
tggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcagt |
20135724 |
T |
 |
| Q |
334 |
gcaccggattgcc |
346 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
20135725 |
gcaccgggttgcc |
20135737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 266 - 346
Target Start/End: Original strand, 1565483 - 1565562
Alignment:
| Q |
266 |
taaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc |
346 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||| ||||||||||||| | |||||| |||| |||||||||||| ||||| |
|
|
| T |
1565483 |
taaggctgcgtacaatgcaccaaatggcgggaccccttcccggaccctgcatatgtgggagc-ttagtgcaccgggttgcc |
1565562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 153 - 236
Target Start/End: Complemental strand, 22861844 - 22861760
Alignment:
| Q |
153 |
gggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| |||||| || | ||| |||| ||| |||||| ||| ||||||||||||||| |
|
|
| T |
22861844 |
gggtaaccttggcacaactgataaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaagcagtctcttgtgtaa |
22861760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 1405208 - 1405323
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||| |||||| |||||||| ||| ||||| |||||||||||||||||||| | ||||| |||| | ||||| | |||| | ||||| |||| | |
|
|
| T |
1405208 |
tggaaacaacctcttatataaaaaatagagtaagtttgcgtacaatacaccaaatggtgggaccctttcctgaaccctgcatatgcgggagctctagtac |
1405307 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
1405308 |
accggattgccctttt |
1405323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 295 - 346
Target Start/End: Original strand, 25622540 - 25622591
Alignment:
| Q |
295 |
ggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc |
346 |
Q |
| |
|
||||| ||||||||||||| |||||| | ||||||||||||||||||||||| |
|
|
| T |
25622540 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcc |
25622591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 256 - 339
Target Start/End: Complemental strand, 12006424 - 12006339
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg |
339 |
Q |
| |
|
||||||||||||||||| | |||||||||||| |||| | ||||| |||||| |||||| | |||| | |||||||||||||||| |
|
|
| T |
12006424 |
aaaaatagggtaaggctccatacaatacaccaataatggtgggaccccttcccagaccctgcctatgcgggagctttagtgcaccg |
12006339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 23974736 - 23974821
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| ||||||||||||| ||||||||||| |
|
|
| T |
23974736 |
aggggtaaccttggcgcaacgg-taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaa |
23974821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 35710268 - 35710354
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||| | || | ||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
35710268 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
35710354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 37024734 - 37024648
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| | |||| | |||||||||||| |||||| || | ||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
37024734 |
aggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
37024648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 232
Target Start/End: Original strand, 38879536 - 38879618
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgt |
232 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
38879536 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt |
38879618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 266 - 338
Target Start/End: Complemental strand, 12477205 - 12477132
Alignment:
| Q |
266 |
taaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||||||||||||||||||| ||||| | ||||| ||||||||| || |||||| |||||||||||||||| |
|
|
| T |
12477205 |
taaggctgcgtacaatacaccaaaatggtgggaccccttcccggattctgcgtatgcaagagctttagtgcacc |
12477132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 271 - 340
Target Start/End: Original strand, 13774921 - 13774990
Alignment:
| Q |
271 |
ctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
||||| ||||||||||||||| |||| | ||| ||||||||| |||||| | ||||||||||||||||| |
|
|
| T |
13774921 |
ctgcgcacaatacaccaaatggcaggatccctttccggaccctgcgtatgcgggagctttagtgcaccgg |
13774990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 39801596 - 39801653
Alignment:
| Q |
295 |
ggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttta |
352 |
Q |
| |
|
||||| |||||| ||||||||||||| | ||||||||||||||||| ||||| ||||| |
|
|
| T |
39801596 |
ggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgccatttta |
39801653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 330
Target Start/End: Original strand, 22600501 - 22600569
Alignment:
| Q |
262 |
agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttt |
330 |
Q |
| |
|
|||||||||||| ||||||||||||||||| | ||| | ||||||||| ||| |||||| | ||||||| |
|
|
| T |
22600501 |
agggtaaggctgtgtacaatacaccaaatggtgggatcccttcccggatcctgcgtatgcgggagcttt |
22600569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 239 - 291
Target Start/End: Complemental strand, 22907976 - 22907924
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatg |
291 |
Q |
| |
|
||||||||||||||| |||||| || |||||| ||| |||||||||||||||| |
|
|
| T |
22907976 |
gaaacagcctcttgtgtaaaaacagagtaaggttgcatacaatacaccaaatg |
22907924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 248 - 351
Target Start/End: Complemental strand, 37226064 - 37225960
Alignment:
| Q |
248 |
tcttgtataaaaatagggtaaggctgcgtacaatac-accaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc |
346 |
Q |
| |
|
|||||||||||||| ||||||| || ||||||||| || ||||| | ||||| ||||||| ||| | |||||| |||| |||||||||| |||||||| |
|
|
| T |
37226064 |
tcttgtataaaaattgggtaagaatgtgtacaatacaacaaaatggtgggaccccttcccgaaccatgcgtatgccagaggtttagtgcactggattgcc |
37225965 |
T |
 |
| Q |
347 |
ttttt |
351 |
Q |
| |
|
|||| |
|
|
| T |
37225964 |
ctttt |
37225960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 153 - 236
Target Start/End: Original strand, 43334159 - 43334243
Alignment:
| Q |
153 |
gggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| ||| ||||||| |
|
|
| T |
43334159 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaa |
43334243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Original strand, 27328730 - 27328793
Alignment:
| Q |
174 |
taaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| |||||| || | ||| || |||||| ||||||||||||||||||||||||| |
|
|
| T |
27328730 |
taaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagtctcttgtgtaa |
27328793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 241 - 340
Target Start/End: Original strand, 39301148 - 39301248
Alignment:
| Q |
241 |
aacagcctcttgtata-aaaatagggtaaggctgcgtacaatacaccaaat-gataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
|||| |||||||| || |||| ||||||||| |||||| ||| ||||||| | | ||||| ||||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
39301148 |
aacaacctcttgtgtataaaacagggtaaggatgcgtataatgcaccaaaaaggtgggaccccttcccggaccctccgtatgtgggag-tttagtgcacc |
39301246 |
T |
 |
| Q |
339 |
gg |
340 |
Q |
| |
|
|| |
|
|
| T |
39301247 |
gg |
39301248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 62; Significance: 1e-26; HSPs: 69)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 237 - 350
Target Start/End: Complemental strand, 33872023 - 33871910
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||| |||||||| |||||| ||| |||||||||||||||||||||||||| | ||||| |||||| |||||| ||||| ||||||||||||||| |
|
|
| T |
33872023 |
tggaaacaacctcttgtgtaaaaacaggataaggctgcgtacaatacaccaaatggtgggaccccttcccagaccctgtgtatgcgagagctttagtgca |
33871924 |
T |
 |
| Q |
337 |
ccggattgcctttt |
350 |
Q |
| |
|
|| | ||||||||| |
|
|
| T |
33871923 |
ccaggttgcctttt |
33871910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 19265836 - 19265938
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||| |||||| ||||| |||||| |||||||||||||||||||||||||||||| | ||||| ||||||||| ||||| |||||| ||||||||||||| |
|
|
| T |
19265836 |
tggatacagccgcttgtgtaaaaagagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgga-cctacatatgtgggagctttagtgca |
19265934 |
T |
 |
| Q |
337 |
ccgg |
340 |
Q |
| |
|
|||| |
|
|
| T |
19265935 |
ccgg |
19265938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 352
Target Start/End: Complemental strand, 21172121 - 21172007
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
21172121 |
tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
21172023 |
T |
 |
| Q |
337 |
ccggattgccttttta |
352 |
Q |
| |
|
|||| ||||| ||||| |
|
|
| T |
21172022 |
ccgggttgccctttta |
21172007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 18512566 - 18512457
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||| | |||||| |||||||||||||||||||||||||||||||| |||| | ||||| ||||||||||||| |||||| | ||||||| ||||| |
|
|
| T |
18512566 |
tggaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgca |
18512467 |
T |
 |
| Q |
337 |
ccggattgcc |
346 |
Q |
| |
|
| || ||||| |
|
|
| T |
18512466 |
ctgggttgcc |
18512457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 2541133 - 2541029
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||| |||||||||||| | ||||| |||||||| |||| |||||| | |||||||||||| |
|
|
| T |
2541133 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtactatacaccaaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgc |
2541034 |
T |
 |
| Q |
336 |
accgg |
340 |
Q |
| |
|
||||| |
|
|
| T |
2541033 |
accgg |
2541029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 38604548 - 38604652
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttt-agtgc |
335 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | |||| ||| ||||||||| |||||| | ||||||| ||||| |
|
|
| T |
38604548 |
tggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgagacccctttccggaccctgcgtatgcgggagctttaagtgc |
38604647 |
T |
 |
| Q |
336 |
accgg |
340 |
Q |
| |
|
||||| |
|
|
| T |
38604648 |
accgg |
38604652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 19427003 - 19426889
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| ||||||||||||||||||||| | ||||| |||| |||||||| | |||| |||||||| ||||| |
|
|
| T |
19427003 |
tggaaacagcctcttgtgtaaaaaatagggtaagactgcgtacaatacaccaaatggtgggacc-cttctcggaccctgcatatgcgagagcttcagtgc |
19426905 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
||||| ||||| |||| |
|
|
| T |
19426904 |
accgggttgccctttt |
19426889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 32758282 - 32758395
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||| ||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
32758282 |
tggaaacagcctcttgtgtaaaac-agggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
32758380 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
32758381 |
ccgggttgccctttt |
32758395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 34626321 - 34626207
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||| ||| |||||| ||||||||||||||| |||||||||||||| | ||| | ||||||||||||| |||||| | |||||||||| || |
|
|
| T |
34626321 |
tggaaacagcctcctgtgtaaaaacagggtaaggctgcgttcaatacaccaaatggtgggatcccttcccggaccctgcgtatgcgggagctttagttca |
34626222 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
||| ||||| |||| |
|
|
| T |
34626221 |
tcgggttgccctttt |
34626207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 42391212 - 42391099
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
42391212 |
tggaaacagcttcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
42391114 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
42391113 |
ccgggttgccctttt |
42391099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 10693185 - 10693077
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
10693185 |
tggaaacagcctcttgtgtaaaag-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
10693087 |
T |
 |
| Q |
337 |
ccggattgcc |
346 |
Q |
| |
|
| || ||||| |
|
|
| T |
10693086 |
ctgggttgcc |
10693077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 264 - 351
Target Start/End: Original strand, 7879687 - 7879774
Alignment:
| Q |
264 |
ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | |||||| |||||||||| ||||| |||| |
|
|
| T |
7879687 |
ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcaccgggttgccctttt |
7879774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 38262310 - 38262195
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||| ||||||| |||||| || ||||| | ||| |||||||||||||||||| ||||| ||||||| || || |||||| | |||||||||||| |
|
|
| T |
38262310 |
tggaaacagtctcttgtgtaaaaaatatggtaatgttgcatacaatacaccaaatgatgggaccccttcccgaacactgcgtatgcgggagctttagtgc |
38262211 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
38262210 |
accggattgccctttt |
38262195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 239 - 352
Target Start/End: Original strand, 40463900 - 40464013
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||||| ||||||| |||||| ||||||||||||||| ||||||||||||| | ||||| |||| |||||||| |||||| | |||||| |||||||| |
|
|
| T |
40463900 |
gaaacagtctcttgtgtaaaaactgggtaaggctgcgtataatacaccaaatggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcacc |
40463999 |
T |
 |
| Q |
339 |
ggattgccttttta |
352 |
Q |
| |
|
| ||||| ||||| |
|
|
| T |
40464000 |
gagttgccctttta |
40464013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 48735234 - 48735126
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||| |||||||| ||||| | |||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
48735234 |
tggaaacaacctcttgtgtaaaac-acggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
48735136 |
T |
 |
| Q |
337 |
ccggattgcc |
346 |
Q |
| |
|
|||| ||||| |
|
|
| T |
48735135 |
ccgggttgcc |
48735126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 237 - 339
Target Start/End: Original strand, 23231578 - 23231681
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||| |||||||||| ||||| ||| |||||||||||||| |||||||| |||||| ||||| ||||||| ||||| |||||| | ||||||||||| |
|
|
| T |
23231578 |
tggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgc |
23231677 |
T |
 |
| Q |
336 |
accg |
339 |
Q |
| |
|
|||| |
|
|
| T |
23231678 |
accg |
23231681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 241 - 352
Target Start/End: Complemental strand, 35787378 - 35787267
Alignment:
| Q |
241 |
aacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
||||||||||||| |||||| | ||||||| |||||||||||||||||||| ||||| ||||||||||| | |||||| | |||||| | |||||||| |
|
|
| T |
35787378 |
aacagcctcttgtgtaaaaacatggtaaggttgcgtacaatacaccaaatggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgg |
35787279 |
T |
 |
| Q |
341 |
attgccttttta |
352 |
Q |
| |
|
||||| ||||| |
|
|
| T |
35787278 |
gttgccctttta |
35787267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 11617702 - 11617592
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||| |||||||| |||||| |||||||| ||||||||||||||||||||| | ||||| ||||| ||||||| |||||| || ||||||||| |
|
|
| T |
11617702 |
tggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcaggacctttagtgc |
11617603 |
T |
 |
| Q |
336 |
accggattgcc |
346 |
Q |
| |
|
||||| ||||| |
|
|
| T |
11617602 |
accgggttgcc |
11617592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 42805545 - 42805662
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||| ||||||||||||| |||| | ||||| |||||||||||| | |||| | |||||||||| |
|
|
| T |
42805545 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagt |
42805644 |
T |
 |
| Q |
334 |
gcaccggattgccttttt |
351 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
42805645 |
gcaccgggttgccctttt |
42805662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 47077967 - 47077854
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||| ||||||| ||||| ||| |||| | |||||||||||||| ||||| | ||||| |||||| ||||||| |||| | ||||| ||||||| |
|
|
| T |
47077967 |
tggaaacagtctcttgtgtaaaa-tagagtaaagttgcgtacaatacacaaaatggtgggaccccttcccaaaccctacatatgcgggagctctagtgca |
47077869 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47077868 |
ccggattgccttttt |
47077854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 47716480 - 47716592
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||| |||| | ||||| |||||||||||| | |||| | ||||||| || |
|
|
| T |
47716480 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttggt |
47716579 |
T |
 |
| Q |
334 |
gcaccggattgcc |
346 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
47716580 |
gcaccgggttgcc |
47716592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 237 - 353
Target Start/End: Complemental strand, 2663047 - 2662933
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| | ||||| ||| | |||||| | |||| | ||||| ||| ||| |
|
|
| T |
2663047 |
tggaaacagcctcttgtgtaaaa-tagggtaaggctgcgtacaatacaccaaatggtgggacc-cttttcagaccctgcatatgcgggagctctagcgca |
2662950 |
T |
 |
| Q |
337 |
ccggattgcctttttat |
353 |
Q |
| |
|
||||||| | ||||||| |
|
|
| T |
2662949 |
ccggattccttttttat |
2662933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 267 - 351
Target Start/End: Complemental strand, 27889399 - 27889315
Alignment:
| Q |
267 |
aaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
||||||||||||||||||||||||| | ||||| ||||||||||||| |||||| | ||||||| || |||||| ||||| |||| |
|
|
| T |
27889399 |
aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgccctttt |
27889315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 1408478 - 1408593
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||| |||||||||| |||||| | |||||||||| |||||||||| |||||| | ||||| ||||||||||||| |||||| | ||||||| | |
|
|
| T |
1408478 |
tggaaatagcctcttgtgtaaaaaacaaggtaaggctgtgtacaatacagcaaatggtgggaccccttcccggaccctgcgtatgcagaatctttagttc |
1408577 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1408578 |
accggattgccttttt |
1408593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 27629655 - 27629770
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| |||||| ||||||||||||| | ||||| |||||||| |||| | |||| | ||||| ||||| |
|
|
| T |
27629655 |
tggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtaaaatacaccaaatggtgggaccccttcccgggccctgcatatgcggtagcttcagtgc |
27629754 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
||||| ||||| |||| |
|
|
| T |
27629755 |
accgggttgccctttt |
27629770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 35334928 - 35334826
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||| ||| |||| ||||| |||||||| ||| |||||||||||| |||| | ||||| ||||||||||||| |||||| ||||||||||||| |
|
|
| T |
35334928 |
tggaaacagtctcgtgta-aaaaacagggtaagactgtgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgca |
35334830 |
T |
 |
| Q |
337 |
ccgg |
340 |
Q |
| |
|
|||| |
|
|
| T |
35334829 |
ccgg |
35334826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 42798690 - 42798805
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||| ||||||| |||||| | |||||||||||||||||||||||||||| | ||||| |||||||||||| | |||| | ||||| |||||| |
|
|
| T |
42798690 |
tggaaacagtctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccctttcccggaccctgcatatgcgggagctatagtgc |
42798789 |
T |
 |
| Q |
336 |
accggattgccttttt |
351 |
Q |
| |
|
| ||| ||||| |||| |
|
|
| T |
42798790 |
atcgggttgccctttt |
42798805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 18747507 - 18747612
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat--agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||||||||||| |||||||||| || | ||||| ||||| | ||||| |||||| | ||||||||||| |
|
|
| T |
18747507 |
tggaaacagccttttgtgtaaaaaagcagggtaaggctgcgtataatacaccaattggtgggaccccttcctgaaccctgcgtatgcgggagctttagtg |
18747606 |
T |
 |
| Q |
335 |
caccgg |
340 |
Q |
| |
|
|||||| |
|
|
| T |
18747607 |
caccgg |
18747612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 239 - 346
Target Start/End: Original strand, 29907442 - 29907549
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaa-tagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||| |||||| ||| |||||||||||| ||||||||| ||||| | ||||| | ||||||||||| ||||| | ||||||||||||| |
|
|
| T |
29907442 |
gaaacagcctcttgtgtaaaaaatagtgtaaggctgcgttcaatacaccaaaatggtgggaccccatcccggaccct--gtatgcgggagctttagtgca |
29907539 |
T |
 |
| Q |
337 |
ccggattgcc |
346 |
Q |
| |
|
|||| ||||| |
|
|
| T |
29907540 |
ccgggttgcc |
29907549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 42798624 - 42798710
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| |||| ||| |||||||| |||| ||||||||||||||||||||| |
|
|
| T |
42798624 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttggaaacagtctcttgtgtaa |
42798710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 46354149 - 46354235
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| ||||||||||| ||| |||||||| ||||||||||||| ||||||||||| |
|
|
| T |
46354149 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgattggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaa |
46354235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 47078033 - 47077947
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47078033 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgtgtaa |
47077947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 353
Target Start/End: Complemental strand, 31591221 - 31591106
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||| |||||||| ||||| || |||||||||||||||||||| ||||| | ||||| ||||||||||| | | |||| | ||||| ||||||| |
|
|
| T |
31591221 |
tggaaacaacctcttgtgtaaaac-agagtaaggctgcgtacaatacaataaatggtgggaccccttcccggaccttgcatatgcgggagctctagtgca |
31591123 |
T |
 |
| Q |
337 |
ccggattgcctttttat |
353 |
Q |
| |
|
|||| ||||| |||||| |
|
|
| T |
31591122 |
ccgggttgcccttttat |
31591106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 43557493 - 43557611
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagc-tttag |
332 |
Q |
| |
|
||||||||||||||||| |||||| || ||||||||||||||||||||||| |||| | ||||| | |||||||| || |||||| | |||| ||||| |
|
|
| T |
43557493 |
tggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgggaccccctcccggactctgcgtatgcgggagcttttag |
43557592 |
T |
 |
| Q |
333 |
tgcaccggattgccttttt |
351 |
Q |
| |
|
|||||||| ||||| |||| |
|
|
| T |
43557593 |
tgcaccgggttgccctttt |
43557611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 155 - 236
Target Start/End: Complemental strand, 7794682 - 7794600
Alignment:
| Q |
155 |
gtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||| || |||| | ||||||||||||||||||| |||| ||| |||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
7794682 |
gtaaccttagcgcaactggtaaagttgttgttatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttatgtaa |
7794600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 251 - 345
Target Start/End: Original strand, 25198762 - 25198856
Alignment:
| Q |
251 |
tgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgc |
345 |
Q |
| |
|
|||| ||||| | |||||| | ||||| ||| ||| ||||| ||||| | |||||| |||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
25198762 |
tgtaaaaaaacaaggtaagaccgcgtataatgcactaaatggtaggatcccttcccagacccttcgtatgtgagagctttagtgcaccgggttgc |
25198856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 42805479 - 42805565
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || ||| | |||||||||||| |||||| |||| ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
42805479 |
aggggtaaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
42805565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 47716414 - 47716500
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| ||||||| | |||||||||| |||||| |||| ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
47716414 |
aggggtaaccttggcacaactggaaaagttgttgccatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
47716500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 257 - 346
Target Start/End: Original strand, 11741835 - 11741924
Alignment:
| Q |
257 |
aaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcc |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||| | ||||||||| || | ||| | ||||| ||||||||||| ||||| |
|
|
| T |
11741835 |
aaaatagggtaaggctgcgtacaatacaccaaatggtgggatcccttcccggattctgcacatgcgggagctctagtgcaccgggttgcc |
11741924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 330
Target Start/End: Original strand, 13805123 - 13805216
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttt |
330 |
Q |
| |
|
|||||| ||||||| || ||||| ||||||||||| ||||||||||||||||| | ||||| ||||| ||||||| |||||| | ||||||| |
|
|
| T |
13805123 |
tggaaatagcctctggtgtaaaacaggggtaaggctgtgtacaatacaccaaatggtgggaccacttcctggaccctgcgtatgcgggagcttt |
13805216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 256 - 329
Target Start/End: Original strand, 19266491 - 19266564
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctt |
329 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| | ||| | ||||||||||||| |||||| | |||||| |
|
|
| T |
19266491 |
aaaaacagggtaaggctgcgtacaatacaccaaattgtgggatcccttcccggaccctgcgtatgcgggagctt |
19266564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 340
Target Start/End: Original strand, 21566456 - 21566561
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaa-tgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
||||||| ||||||||| |||||| || | ||| ||||||||||||||||||| || ||||||| ||||||| ||||| | |||| | ||||||||||| |
|
|
| T |
21566456 |
tggaaaccgcctcttgtgtaaaaaacagaggaagactgcgtacaatacaccaaaatggtaggaccccttcccgaaccctgcatatgcgggagctttagtg |
21566555 |
T |
 |
| Q |
335 |
caccgg |
340 |
Q |
| |
|
|||||| |
|
|
| T |
21566556 |
caccgg |
21566561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 305
Target Start/End: Complemental strand, 23419788 - 23419719
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcc |
305 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||||||||||||||||||||| | ||||| ||||| |
|
|
| T |
23419788 |
tggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcc |
23419719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 256 - 336
Target Start/End: Complemental strand, 8149039 - 8148960
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| | ||||| |||||| || | | |||||| ||||| ||||||||| |
|
|
| T |
8149039 |
aaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccaga-cttgcgtatgcgagagttttagtgca |
8148960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 256 - 320
Target Start/End: Complemental strand, 14099100 - 14099036
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatg |
320 |
Q |
| |
|
||||| ||| |||| ||||||||||||||||||||| | ||||| ||||||| |||||||||||| |
|
|
| T |
14099100 |
aaaaacaggttaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctacgtatg |
14099036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 256 - 320
Target Start/End: Complemental strand, 14409117 - 14409053
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatg |
320 |
Q |
| |
|
||||| ||| |||| ||||||||||||||||||||| | ||||| ||||||| |||||||||||| |
|
|
| T |
14409117 |
aaaaacaggttaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctacgtatg |
14409053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 264 - 340
Target Start/End: Complemental strand, 28362231 - 28362156
Alignment:
| Q |
264 |
ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||| |||||| |||| | | |||||| ||||||| ||||||||| |
|
|
| T |
28362231 |
ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccagaccttgcatatgtgggagcttt-gtgcaccgg |
28362156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 239 - 340
Target Start/End: Original strand, 16341301 - 16341404
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||| ||||||||||||| ||||| | || |||||||||||||| | |||| | ||||||| ||||| |
|
|
| T |
16341301 |
gaaacagcctcttgtgtaaaaaacagggtaaggctacgtacaatacaccaaaatggtgggccctcttcccggacctatcatatgcgggagctttggtgca |
16341400 |
T |
 |
| Q |
337 |
ccgg |
340 |
Q |
| |
|
|||| |
|
|
| T |
16341401 |
ccgg |
16341404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 312
Target Start/End: Original strand, 46354215 - 46354293
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccc |
312 |
Q |
| |
|
|||||||| |||||||| |||||| |||||||||||||||||||||||||| |||| | ||||| |||||||||||| |
|
|
| T |
46354215 |
tggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccc |
46354293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 18326989 - 18327075
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| | || ||| |||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
18326989 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgacttgaaggtcacgggttcaagtcccggaaacagcctcttgtgtaa |
18327075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 22699150 - 22699064
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| | |||| | |||||||||||| |||||| || | ||||| ||||||| |||||||||| |||||||||||||| |
|
|
| T |
22699150 |
aggggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggttatgggttcaagtcctggaaatagtctcttgtgtaa |
22699064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 32758216 - 32758302
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| || ||||| |||||||||||||| ||||||||||| |
|
|
| T |
32758216 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaa |
32758302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 272 - 353
Target Start/End: Complemental strand, 23066003 - 23065922
Alignment:
| Q |
272 |
tgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcctttttat |
353 |
Q |
| |
|
|||||||||||||||| ||||| ||| | ||| ||| | ||| | |||||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
23066003 |
tgcgtacaatacaccatatgatgggatccctttccgaatcctgcatatgtgggagctttggtgcaccggattgcccttttat |
23065922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 239 - 331
Target Start/End: Complemental strand, 28078243 - 28078151
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagcttta |
331 |
Q |
| |
|
||||||| ||| |||| ||||| ||||||||| ||| | |||||||||||||| | ||||| ||||||| | ||| | |||| |||||||||| |
|
|
| T |
28078243 |
gaaacagtctcgtgtaaaaaaacagggtaaggttgcatgcaatacaccaaatggtgggaccccttcccgaatcctgcatatgcgagagcttta |
28078151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 237 - 305
Target Start/End: Original strand, 42476894 - 42476961
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcc |
305 |
Q |
| |
|
||||||||| ||||||| ||||| ||| |||||||||||||||||||||||||| | ||||| ||||| |
|
|
| T |
42476894 |
tggaaacagtctcttgtgtaaaacaagg-taaggctgcgtacaatacaccaaatggtgggaccccttcc |
42476961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Complemental strand, 1424067 - 1424004
Alignment:
| Q |
174 |
taaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
||||||||||||||||||| |||| ||| |||| ||| | ||||||||||||||| |||||||| |
|
|
| T |
1424067 |
taaagttgttgttatgtgactggaaggtcacggattcaaatcctggaaacagtctgttgtgtaa |
1424004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 240 - 291
Target Start/End: Original strand, 6736914 - 6736965
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatg |
291 |
Q |
| |
|
||||| ||||||||||||||| | |||||| |||| |||||||||||||||| |
|
|
| T |
6736914 |
aaacaacctcttgtataaaaacaaggtaagactgcatacaatacaccaaatg |
6736965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Complemental strand, 10693228 - 10693165
Alignment:
| Q |
174 |
taaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| |||||| || | ||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
10693228 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
10693165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 32233248 - 32233145
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||| |||||||| |||||| |||||||||| ||||| | ||||||||||| | ||| |||||| ||||| | |||| | |||||| |||||| |
|
|
| T |
32233248 |
tggaaacaacctcttgtgtaaaaacagggtaaggcagcgtatattacaccaaatggtgggattccttcccaaaccctgcatatgagggagcttcagtgca |
32233149 |
T |
 |
| Q |
337 |
ccgg |
340 |
Q |
| |
|
|||| |
|
|
| T |
32233148 |
ccgg |
32233145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 21447545 - 21447631
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| |||||| ||||||| |||| |||||| ||| |||| ||| |||| || |||||| ||||||||||| |
|
|
| T |
21447545 |
aggggtaaccttggcgcaactgataaatttgttgtcatgtaattggaaggtcacggattcaagtcttgaaaacagcctcttgtgtaa |
21447631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 228
Target Start/End: Complemental strand, 35334994 - 35334916
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctc |
228 |
Q |
| |
|
|||| ||||||| || |||| | |||||||||||| |||||| |||| ||| ||| |||| |||||||||||||||||| |
|
|
| T |
35334994 |
agggataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgagttcaagtcctggaaacagtctc |
35334916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 268 - 341
Target Start/End: Complemental strand, 36267900 - 36267826
Alignment:
| Q |
268 |
aggctgcgtacaatacaccaaatgatagga-cctcttcccggaccctacgtatgtgagagctttagtgcaccgga |
341 |
Q |
| |
|
|||||||||||||||||||||||| | ||| || |||||| ||||| ||||| | |||||||||||||||||| |
|
|
| T |
36267900 |
aggctgcgtacaatacaccaaatggttggacccatttcccgaaccctgtgtatgcgggagctttagtgcaccgga |
36267826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 267 - 338
Target Start/End: Original strand, 39123945 - 39124018
Alignment:
| Q |
267 |
aaggctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||||||||| ||||||||||| || | ||||| ||||||||||||| |||||| | ||||||| ||||||| |
|
|
| T |
39123945 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc |
39124018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 232
Target Start/End: Complemental strand, 42496015 - 42495933
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgt |
232 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| || ||| || | ||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
42496015 |
aggggtaaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt |
42495933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 43557427 - 43557513
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| | |||| | |||||||||||| |||||| || | ||| | ||||||| ||||||||||||| ||||||||||| |
|
|
| T |
43557427 |
aggggtaaccttgccgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaa |
43557513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 282
Target Start/End: Original strand, 22065609 - 22065654
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaata |
282 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| ||||| ||||||| |
|
|
| T |
22065609 |
tggaaacaacctcttgtgtaaaaatagggtaaagctgcatacaata |
22065654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 156 - 236
Target Start/End: Original strand, 40463837 - 40463918
Alignment:
| Q |
156 |
taaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||| | ||||||||||||||||||| |
|
|
| T |
40463837 |
taaccttggcgcaaccggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatagaaacagtctcttgtgtaa |
40463918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 270
Target Start/End: Complemental strand, 42495949 - 42495916
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaagg |
270 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
42495949 |
tggaaacagcctcttgtataaaaacagggtaagg |
42495916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 256 - 340
Target Start/End: Complemental strand, 22699064 - 22698977
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaa--tgataggacc-tcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||| || | ||||| | |||||||||||| ||||| | ||||| ||||||||||| |
|
|
| T |
22699064 |
aaaaacagggtaagactgcgtacaatacaccaaaaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtgcaccgg |
22698977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 352
Target Start/End: Complemental strand, 48746 - 48632
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
48746 |
tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
48648 |
T |
 |
| Q |
337 |
ccggattgccttttta |
352 |
Q |
| |
|
|||| ||||| ||||| |
|
|
| T |
48647 |
ccgggttgccctttta |
48632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 60; Significance: 2e-25; HSPs: 35)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 237 - 352
Target Start/End: Complemental strand, 1354869 - 1354755
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
1354869 |
tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
1354771 |
T |
 |
| Q |
337 |
ccggattgccttttta |
352 |
Q |
| |
|
|||| ||||| ||||| |
|
|
| T |
1354770 |
ccgggttgccctttta |
1354755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 26097181 - 26097294
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
26097181 |
tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatgaagggaccccttcccggaccctgcatatgcgggagctctagtgca |
26097279 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
26097280 |
ccgggttgccctttt |
26097294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 29355971 - 29355854
Alignment:
| Q |
237 |
tggaaacagcctcttgtataa-aaatagggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
||||||||||||||||| ||| ||| ||||||||||||||||||||||||||| ||| | ||||| ||||||||||||| |||||| | |||||||||| |
|
|
| T |
29355971 |
tggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagt |
29355872 |
T |
 |
| Q |
334 |
gcaccggattgccttttt |
351 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
29355871 |
gcaccgggttgccctttt |
29355854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 1346985 - 1347098
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
1346985 |
tggaaacagccacttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
1347083 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
1347084 |
ccgggttgccctttt |
1347098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 25557746 - 25557859
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| | ||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
25557746 |
tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatgaaggaaccccttcccggaccctgcatatgcgggagctctagtgca |
25557844 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
25557845 |
ccgggttgccctttt |
25557859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 12222031 - 12221913
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagc-tttag |
332 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||| |||| | ||||| ||||||||||||| |||||| | |||| ||||| |
|
|
| T |
12222031 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagcttttag |
12221932 |
T |
 |
| Q |
333 |
tgcaccggattgccttttt |
351 |
Q |
| |
|
|||||||| ||||| |||| |
|
|
| T |
12221931 |
tgcaccgggttgccctttt |
12221913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 237 - 333
Target Start/End: Original strand, 32579447 - 32579543
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||| ||||||||||||| ||||||| | ||||| |||||| |||||| | |||| | |||||||||| |
|
|
| T |
32579447 |
tggaaacagcctctggtataaaaatacggtaagcctgcgtacaataccccaaatggtgggaccccttcccagaccctgcatatgcgggagctttagt |
32579543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 9161144 - 9161260
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
||||||||||||||||| |||||| || |||||||||||||||||||| || |||| | ||||| |||| |||||||| |||||| | |||||||||| |
|
|
| T |
9161144 |
tggaaacagcctcttgtgtaaaaacagagtaaggctgcgtacaatacatcaataatggtgggaccccttctcggaccctgcgtatgcggaagctttagtg |
9161243 |
T |
 |
| Q |
335 |
caccggattgccttttt |
351 |
Q |
| |
|
|||| | ||||| |||| |
|
|
| T |
9161244 |
caccaggttgccctttt |
9161260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 7947486 - 7947384
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
|||||||| |||| ||| |||||| ||||||||||||||||||||||||| ||||| | || || ||||||||||| | |||||||| ||||||||||| |
|
|
| T |
7947486 |
tggaaacaacctcctgtgtaaaaaccagggtaaggctgcgtacaatacaccaaaatggtgggcccccttcccggaccttgcgtatgtgggagctttagtg |
7947387 |
T |
 |
| Q |
335 |
cac |
337 |
Q |
| |
|
||| |
|
|
| T |
7947386 |
cac |
7947384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 256 - 340
Target Start/End: Complemental strand, 3815171 - 3815087
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccgg |
340 |
Q |
| |
|
||||||| |||| | ||||||||||||||||||||| | ||||| |||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
3815171 |
aaaaatatggtacgactgcgtacaatacaccaaatggtgggaccctttcccgaaccctacgtatgcggaagctttagtgcaccgg |
3815087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 18277307 - 18277203
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||| || ||||| |||||||||| | ||||| ||||| ||| ||||||||| | |||||||| ||| |
|
|
| T |
18277307 |
tggaaacagcctcttgtgtaaaaatcagggtaaggttgagtacagaacaccaaatggtgggaccccttcctagactctacgtatgcgggagctttactgc |
18277208 |
T |
 |
| Q |
336 |
accgg |
340 |
Q |
| |
|
||||| |
|
|
| T |
18277207 |
accgg |
18277203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 2166526 - 2166409
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
|||||||| |||||||| ||||| | ||| ||||| ||||||||||||||||| ||| | ||||| |||||||||||||| ||| | |||||||||| |
|
|
| T |
2166526 |
tggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagt |
2166427 |
T |
 |
| Q |
334 |
gcaccggattgccttttt |
351 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
2166426 |
gcaccgggttgccctttt |
2166409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 2178159 - 2178042
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaa--atgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
|||||||| |||||||| ||||| | ||| ||||| ||||||||||||||||| ||| | ||||| |||||||||||||| ||| | |||||||||| |
|
|
| T |
2178159 |
tggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagt |
2178060 |
T |
 |
| Q |
334 |
gcaccggattgccttttt |
351 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
2178059 |
gcaccgggttgccctttt |
2178042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 239 - 312
Target Start/End: Original strand, 6024256 - 6024332
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacca--aatgataggacctcttcccggaccc |
312 |
Q |
| |
|
||||||||||||||| |||||| | |||||| ||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
6024256 |
gaaacagcctcttgtgtaaaaaacatggtaagactgcgtacaatacaccaataatgatgggacctcttcccggaccc |
6024332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 352
Target Start/End: Original strand, 12885967 - 12886050
Alignment:
| Q |
271 |
ctgcgtacaatacaccaaa--tgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttta |
352 |
Q |
| |
|
||||||||||||||| ||| || | ||||| |||||| |||||| |||||||| ||||||||||||||||| ||||| ||||| |
|
|
| T |
12885967 |
ctgcgtacaatacacaaaaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgccctttta |
12886050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 237 - 339
Target Start/End: Original strand, 33138854 - 33138957
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||||| ||||||||||||||| || ||||||| ||||||||||||||||||| | ||||| || ||||||||| ||||| ||||||||||| |
|
|
| T |
33138854 |
tggaaacaacctcttgtataaaaaacagagtaaggccgcgtacaatacaccaaatggtgggacccttttccggaccctgtgtatgcagtagctttagtgc |
33138953 |
T |
 |
| Q |
336 |
accg |
339 |
Q |
| |
|
|||| |
|
|
| T |
33138954 |
accg |
33138957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 1346919 - 1347005
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| |||||||| |||||||||||||| | ||||||||| |
|
|
| T |
1346919 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagccacttgtgtaa |
1347005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 240 - 336
Target Start/End: Original strand, 12889450 - 12889548
Alignment:
| Q |
240 |
aaacagcctcttgtat-aaaaatagggtaaggctgcgtacaatacacc-aaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||||||||| | ||||| |||| |||||||| ||||||||||| ||| ||| ||||| ||| ||||||||| || |||| ||||||||||||| |
|
|
| T |
12889450 |
aaacagcctcttgtgttaaaaacagggcaaggctgcatacaatacacctaaacgatgggacccctttccggaccctctgtgtgtgggagctttagtgca |
12889548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Complemental strand, 14975260 - 14975174
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||| ||||||| || |||| | |||||||||||| |||||| |||| ||| |||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
14975260 |
agggataaccttggcgcaaccggtaaagttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcctcttgtgtaa |
14975174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 278 - 351
Target Start/End: Original strand, 13267788 - 13267861
Alignment:
| Q |
278 |
caatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
|||||||||||||| | ||||| ||||| ||||||| |||||| | |||||| |||||||||| ||||| |||| |
|
|
| T |
13267788 |
caatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgccctttt |
13267861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 272 - 353
Target Start/End: Complemental strand, 23930205 - 23930124
Alignment:
| Q |
272 |
tgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgcctttttat |
353 |
Q |
| |
|
|||||||||||||||| ||| | ||||| |||| |||||||| | |||| | |||||||||||||||| ||||| |||||| |
|
|
| T |
23930205 |
tgcgtacaatacaccagatggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgcccttttat |
23930124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 237 - 306
Target Start/End: Original strand, 28007649 - 28007717
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttccc |
306 |
Q |
| |
|
|||||| |||||||||| ||||| ||||| |||||||||||||||||||||||| | ||||| |||||| |
|
|
| T |
28007649 |
tggaaagagcctcttgtgtaaaac-agggtcaggctgcgtacaatacaccaaatgctgggaccccttccc |
28007717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Complemental strand, 2166569 - 2166506
Alignment:
| Q |
174 |
taaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
||||||||||||||||||| || | ||| |||||||| ||||||||||||| ||||||||||| |
|
|
| T |
2166569 |
taaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaa |
2166506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Complemental strand, 2178202 - 2178139
Alignment:
| Q |
174 |
taaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
||||||||||||||||||| || | ||| |||||||| ||||||||||||| ||||||||||| |
|
|
| T |
2178202 |
taaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaa |
2178139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 243 - 334
Target Start/End: Original strand, 24097608 - 24097696
Alignment:
| Q |
243 |
cagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtg |
334 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||| ||||||| | ||||| ||||||||||||| |||||| | |||||||||| |
|
|
| T |
24097608 |
cagcctcttgtataaaaaacagggtaaggctgcttacaa----ccaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtg |
24097696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 8409198 - 8409284
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| |||| ||| |||||||||||| | ||||||||||| |
|
|
| T |
8409198 |
aggggtaaccttggcgcaactggtaaagttgttgtaatgtgactgaaaggtcacggattcaagtcctggaaactgcctcttgtgtaa |
8409284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 256 - 289
Target Start/End: Complemental strand, 2755518 - 2755485
Alignment:
| Q |
256 |
aaaaatagggtaaggctgcgtacaatacaccaaa |
289 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
2755518 |
aaaaataggctaaggctgcgtacaatacaccaaa |
2755485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 152 - 236
Target Start/End: Complemental strand, 3815256 - 3815171
Alignment:
| Q |
152 |
ggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
||||||||||| || |||| | |||||||||||| |||||| || | || |||||||| |||||||||||||| || |||||||| |
|
|
| T |
3815256 |
ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcctggaaacagactattgtgtaa |
3815171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 287 - 343
Target Start/End: Complemental strand, 16916050 - 16915993
Alignment:
| Q |
287 |
aaatgataggacctc-ttcccggaccctacgtatgtgagagctttagtgcaccggatt |
343 |
Q |
| |
|
||||| ||||||||| |||| |||||||| |||||| |||||||||||||||||||| |
|
|
| T |
16916050 |
aaatggtaggacctccttcctagaccctacatatgtgggagctttagtgcaccggatt |
16915993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 240 - 291
Target Start/End: Original strand, 1941879 - 1941931
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatg |
291 |
Q |
| |
|
||||| |||||||| |||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
1941879 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccgaatg |
1941931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 295 - 351
Target Start/End: Original strand, 6808475 - 6808531
Alignment:
| Q |
295 |
ggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
||||| ||||||||||||| ||||| | ||||||||||||||||| ||||| |||| |
|
|
| T |
6808475 |
ggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccctttt |
6808531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 313
Target Start/End: Complemental strand, 15865970 - 15865894
Alignment:
| Q |
237 |
tggaaacagcctctt--gtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct |
313 |
Q |
| |
|
||||||||||||||| ||| ||||| ||||||| |||||||| |||||||||||| | ||||| ||||| ||||||| |
|
|
| T |
15865970 |
tggaaacagcctcttacgtaaaaaaacagggtaaagctgcgta--atacaccaaatggtgggaccccttcctggaccct |
15865894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 313
Target Start/End: Complemental strand, 15866151 - 15866076
Alignment:
| Q |
237 |
tggaaacagcctctt--gtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccct |
313 |
Q |
| |
|
||||||||||||||| ||| ||||| ||||||| |||||||| |||||||||||| | ||||| ||||||||||||| |
|
|
| T |
15866151 |
tggaaacagcctcttaagta-aaaaacagggtaaagctgcgta--atacaccaaatggtgggaccccttcccggaccct |
15866076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 337
Target Start/End: Complemental strand, 23240936 - 23240837
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||| ||||| || | ||||| |||| |||| | |||||| | ||||||||||||| |
|
|
| T |
23240936 |
tggaaacagcctcttgtgtaaaac-agggtaagtttgcgtacaatataccaattggtgggaccccttctaggacaatgcgtatgcgggagctttagtgca |
23240838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 251 - 287
Target Start/End: Complemental strand, 27855536 - 27855500
Alignment:
| Q |
251 |
tgtataaaaatagggtaaggctgcgtacaatacacca |
287 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
27855536 |
tgtaaaaaaatagggtaaggctgcgtataatacacca |
27855500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 55; Significance: 2e-22; HSPs: 2)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Complemental strand, 13137 - 13023
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
|||||||||||||||| |||||| | ||||||||||||||||||||||| |||| | ||||| |||||| |||||| |||||| | | ||||||||||| |
|
|
| T |
13137 |
tggaaacagcctcttgcgtaaaaacaaggtaaggctgcgtacaatacaccgaatggtgggaccccttcccagaccctgcgtatgcgggggctttagtgca |
13038 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
13037 |
ccgggttgccctttt |
13023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 152 - 236
Target Start/End: Complemental strand, 13202 - 13117
Alignment:
| Q |
152 |
ggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
||||||||||| || |||| | |||||||||||| |||||| || | ||| || ||||| |||||||||||||| |||||| |||| |
|
|
| T |
13202 |
ggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgcgtaa |
13117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 55; Significance: 2e-22; HSPs: 2)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 237 - 351
Target Start/End: Original strand, 30600 - 30713
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| |||||| ||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
30600 |
tggaaacagcctcttgtgtaaaac-agggtagggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca |
30698 |
T |
 |
| Q |
337 |
ccggattgccttttt |
351 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
30699 |
ccgggttgccctttt |
30713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 151 - 236
Target Start/End: Original strand, 30534 - 30620
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||| |||||| || | ||| || ||||| |||||||||||||| ||||||||||| |
|
|
| T |
30534 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgtgtaa |
30620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 263 - 351
Target Start/End: Complemental strand, 24220 - 24132
Alignment:
| Q |
263 |
gggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccggattgccttttt |
351 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||| ||||||||||||| | |||| | ||||| ||||||||||||||||| |||| |
|
|
| T |
24220 |
gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccctttt |
24132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 51; Significance: 5e-20; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 240 - 350
Target Start/End: Complemental strand, 1696 - 1587
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcaccg |
339 |
Q |
| |
|
||||| |||||||| ||||| ||| ||||||||| |||||||||||||||||| ||||| |||||||||||| |||||| | ||||||||||||||| |
|
|
| T |
1696 |
aaacaacctcttgtgtaaaac-aggataaggctgcatacaatacaccaaatgatgggaccccttcccggacccggcgtatgcgggagctttagtgcacca |
1598 |
T |
 |
| Q |
340 |
gattgcctttt |
350 |
Q |
| |
|
| ||||||||| |
|
|
| T |
1597 |
ggttgcctttt |
1587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0954 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: scaffold0954
Description:
Target: scaffold0954; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 237 - 339
Target Start/End: Original strand, 3565 - 3668
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaa-atagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgc |
335 |
Q |
| |
|
|||||| |||||||||| ||||| ||| |||||||||||||| |||||||| |||||| ||||| ||||||| ||||| |||||| | ||||||||||| |
|
|
| T |
3565 |
tggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgc |
3664 |
T |
 |
| Q |
336 |
accg |
339 |
Q |
| |
|
|||| |
|
|
| T |
3665 |
accg |
3668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 240 - 337
Target Start/End: Original strand, 10834 - 10932
Alignment:
| Q |
240 |
aaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcac |
337 |
Q |
| |
|
||||| |||||||| |||||| |||||| |||||||| |||||||||||||| | ||||| ||||||||||||| |||||| | |||||||||||||| |
|
|
| T |
10834 |
aaacaacctcttgtgtaaaaaacagggtagggctgcgtccaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
10932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 46; Significance: 5e-17; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 58998 - 59110
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaat-agggtaaggctgcgtacaatacacc--aaatgataggacctcttcccggaccctacgtatgtgagagctttagt |
333 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||| ||||| | ||||| |||||| ||| || |||||| | |||||||||| |
|
|
| T |
58998 |
tggaaacagcctcttgtataaaaaacagggtaagactgcgtacaatacaccaaaaatggtgggaccccttcccagactctgcgtatgcgggagctttagt |
59097 |
T |
 |
| Q |
334 |
gcaccggattgcc |
346 |
Q |
| |
|
||| ||| ||||| |
|
|
| T |
59098 |
gcatcgggttgcc |
59110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 264 - 338
Target Start/End: Complemental strand, 72953 - 72879
Alignment:
| Q |
264 |
ggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgcacc |
338 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||| ||||||||| ||| |||||| | ||||||||||||||| |
|
|
| T |
72953 |
ggtaaggctgcctacaatacaccaaatggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcacc |
72879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 338
Target Start/End: Original strand, 11152 - 11252
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| | | ||||||||| |||||||||||||||| | |||| ||||||||||||| | |||| | ||||| ||||||| |
|
|
| T |
11152 |
tggaaacagcctcttgtgtaaaacaaag-taaggctgcttacaatacaccaaatggtgggacaccttcccggaccctgcatatgcgggagctctagtgca |
11250 |
T |
 |
| Q |
337 |
cc |
338 |
Q |
| |
|
|| |
|
|
| T |
11251 |
cc |
11252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 38; Significance: 0.000000000003; HSPs: 4)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 10162 - 10054
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| || ||||| |||||||||||||||||||| | ||||| ||||||||||||| | |||| ||||| |||||| |
|
|
| T |
10162 |
tggaaacagcctcttgtgtaaaac-agagtaagactgcgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgca |
10064 |
T |
 |
| Q |
337 |
ccggattgcc |
346 |
Q |
| |
|
|||| ||||| |
|
|
| T |
10063 |
ccgggttgcc |
10054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 237 - 346
Target Start/End: Complemental strand, 20490 - 20382
Alignment:
| Q |
237 |
tggaaacagcctcttgtataaaaatagggtaaggctgcgtacaatacaccaaatgataggacctcttcccggaccctacgtatgtgagagctttagtgca |
336 |
Q |
| |
|
||||||||||||||||| ||||| || ||||| |||||||||||||||||||| | ||||| ||||||||||||| | |||| ||||| |||||| |
|
|
| T |
20490 |
tggaaacagcctcttgtgtaaaac-agagtaagactgcgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgca |
20392 |
T |
 |
| Q |
337 |
ccggattgcc |
346 |
Q |
| |
|
|||| ||||| |
|
|
| T |
20391 |
ccgggttgcc |
20382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 153 - 236
Target Start/End: Complemental strand, 10226 - 10142
Alignment:
| Q |
153 |
gggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||| | |||| | |||||||||||| |||||| || | ||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
10226 |
gggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
10142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 153 - 236
Target Start/End: Complemental strand, 20554 - 20470
Alignment:
| Q |
153 |
gggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttca-gtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
|||||||||| | |||| | |||||||||||| |||||| || | ||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
20554 |
gggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaa |
20470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 236
Target Start/End: Original strand, 4135 - 4198
Alignment:
| Q |
174 |
taaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacagtctcttgtgtaa |
236 |
Q |
| |
|
||||||||||||||||||| || | ||| |||||||| ||||||||||||| ||||||||||| |
|
|
| T |
4135 |
taaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaa |
4198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 224
Target Start/End: Original strand, 24619 - 24693
Alignment:
| Q |
151 |
aggggtaaccttcgcacaacagataaagttgttgttatgtgattggatggttacgggttc-agtcctggaaacag |
224 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||| | |||| || | ||| |||||||| |||||||||||||| |
|
|
| T |
24619 |
aggggtaaccttggcacaattgataaagttgttgtcaagtgactgtaaggtcacgggttcaagtcctggaaacag |
24693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 257 - 291
Target Start/End: Complemental strand, 35110 - 35076
Alignment:
| Q |
257 |
aaaatagggtaaggctgcgtacaatacaccaaatg |
291 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
35110 |
aaaacagggtaaggctgcgtacaatacaccaaatg |
35076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 239 - 300
Target Start/End: Complemental strand, 226518 - 226455
Alignment:
| Q |
239 |
gaaacagcctcttgtataaaaata--gggtaaggctgcgtacaatacaccaaatgataggacct |
300 |
Q |
| |
|
||||||||||||||| |||||| | |||||||||||| ||||||||| |||||| | |||||| |
|
|
| T |
226518 |
gaaacagcctcttgtctaaaaaaacagggtaaggctgcatacaatacatcaaatggtgggacct |
226455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University