View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9524_high_3 (Length: 247)

Name: NF9524_high_3
Description: NF9524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9524_high_3
NF9524_high_3
[»] chr1 (1 HSPs)
chr1 (12-182)||(9551251-9551421)


Alignment Details
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 12 - 182
Target Start/End: Complemental strand, 9551421 - 9551251
Alignment:
12 attatactttgaacaaattttgattggatttttaaaggggacatttttatatatttggtgtgtttaatcaatgtgttagtttaatcaattttggattttg 111  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9551421 attataatttgaacaaattttgattggatttttaaaggggacatttttatatatttggtgtgtttaatcaatgtgttagtttaatcaattttggattttg 9551322  T
112 attttgaaaggggacacatttaccatttggaattatatttgattatgtgtgagttaatttggggttaaatt 182  Q
    |||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||    
9551321 attttgaaaggggacacatttaccatttggaattatatttgatgttgtgtgagttaatttggggttaaatt 9551251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University