View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9525_low_2 (Length: 229)
Name: NF9525_low_2
Description: NF9525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9525_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 26 - 215
Target Start/End: Complemental strand, 33252124 - 33251933
Alignment:
| Q |
26 |
atatcaaaccatacacata--catcatgattgacatatcttctaacatgatatatacataagtcacattcagattaatatatacatgattatatcatggc |
123 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33252124 |
atatcaaaccatacacatatacatcatgattgacatatcttctaacatgatatatacataagtcacattcagattaatatatacatgattatatcatggc |
33252025 |
T |
 |
| Q |
124 |
ctatgacacatcgttctttagcatagcatgaatgtaaccaaccccacaacttgacacaatccaaaaccattgacgtttacccctacaacacg |
215 |
Q |
| |
|
|| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33252024 |
ctttgacgcatcgttctttagcatagcatgaatgtaaccaaccccacaacttgacacaatccaaaaccattgacgtttacccctacaacacg |
33251933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University