View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9526_high_11 (Length: 239)
Name: NF9526_high_11
Description: NF9526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9526_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 22 - 223
Target Start/End: Complemental strand, 48568474 - 48568273
Alignment:
| Q |
22 |
gacaataaccaagttgacatgatggcatttcttatatagcattcatttcccttattatactccagattttttattacattttcttgctttaaatcacacg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48568474 |
gacaataaccaagttgacatgatggcatttcttatatagcattcatttcccttattatactccagattttttattacattttcttgctttaaatcacacg |
48568375 |
T |
 |
| Q |
122 |
agtgattagtctgcttaaattggtgcacacctttgatcattgcttttgtctgcttcagcgactcgtggtgctggtacatagtcaatctgataatcacctt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48568374 |
agtgattagtctgcttaaattggtgcacacctttgatcattgcttttgtctgcttcagtgactcgtggtgctggtacatagtcaatctgataatcacctt |
48568275 |
T |
 |
| Q |
222 |
tc |
223 |
Q |
| |
|
|| |
|
|
| T |
48568274 |
tc |
48568273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 124 - 223
Target Start/End: Complemental strand, 36144389 - 36144291
Alignment:
| Q |
124 |
tgattagtctgcttaaattggtgcacacctttgatcattgcttttgtctgcttcagcgactcgtggtgctggtacatagtcaatctgataatcacctttc |
223 |
Q |
| |
|
|||| |||||||| ||||||||||| ||||| ||||||| |||||||||||| | || ||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36144389 |
tgatcagtctgct-aaattggtgcataccttcgatcattttgtttgtctgcttcggtgattcgcggtgctggcacatagtcaatctgataatcacctttc |
36144291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 140 - 223
Target Start/End: Original strand, 10822963 - 10823046
Alignment:
| Q |
140 |
attggtgcacacctttgatcattgcttttgtctgcttcagcgactcgtggtgctggtacatagtcaatctgataatcacctttc |
223 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||| | || ||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10822963 |
attggtgcataccttcgatcattttgtttgtctgcttcggtgattcgcggtgctggcacatagtcaatctgataatcacctttc |
10823046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University