View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9526_low_12 (Length: 357)
Name: NF9526_low_12
Description: NF9526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9526_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 39 - 345
Target Start/End: Complemental strand, 43004061 - 43003754
Alignment:
| Q |
39 |
ggaattcgaacaccggacacgccactagctctagtacttgaccnnnnnnnnn-taaaagaatacgcttttgtttctaattgactcgcctttatattctca |
137 |
Q |
| |
|
||||||| |||||||||||||||| | ||||| |||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43004061 |
ggaattcaaacaccggacacgccagtggctctggtacttgaccaaaagaaaaataaaagaataggcttttgtttctaattgactcgcctttatattctca |
43003962 |
T |
 |
| Q |
138 |
catccacacacttctggttttttcaccaccgtaggttaactaaactcacatctgcgaccgacgggagatgaagttcagccatggctgttggtcgacagta |
237 |
Q |
| |
|
| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003961 |
cttccacacacttctggtttttccaccaccgtaggttaaccaaactcacatctgcgaccgacgggagatgaagttcagccatggctgttggtcgacagta |
43003862 |
T |
 |
| Q |
238 |
ctggagatgcgcatgtgtttaaggccggagcgcttgacatcatgaggcgtactggcctcaccttacgtgaccttagaagaatcctagaccctatcttttc |
337 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003861 |
ctggagatgcacatgtgtttaaggccggagcgcttgacatcatgaggcgtactggcctcaccttacgtgaccttagaagaatcctagaccctatcttttc |
43003762 |
T |
 |
| Q |
338 |
ctcccctt |
345 |
Q |
| |
|
|||||||| |
|
|
| T |
43003761 |
ctcccctt |
43003754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University