View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9526_low_25 (Length: 250)
Name: NF9526_low_25
Description: NF9526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9526_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 3 - 228
Target Start/End: Complemental strand, 29115383 - 29115158
Alignment:
| Q |
3 |
acaagatgagataatgcacccaaattcaaaagtccttattatctagcttgtcactgaacagagtctgttaataaattattttatactgttttcacgataa |
102 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| | | ||| || ||||| ||||||| |||||||||||||| |
|
|
| T |
29115383 |
acaagatgagataatgcactcaaattcaaaagtccttattatctagcttgttatattttaaagtggaatatgaaattgttttatattgttttcacgataa |
29115284 |
T |
 |
| Q |
103 |
tgttactatactaagaatattatgtgaaactttggtttactatcaatatattttttagtgtcactattaacaaagtttgattcaacaaatttgtgctaca |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29115283 |
tgttactatactaagaatattatgtgaaactttggtttactatcaatatattttttagtgtcgctattaacaaagtttgattcaacaaatttgtgctaca |
29115184 |
T |
 |
| Q |
203 |
ctggtaaaatatgttcatgctattcg |
228 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
29115183 |
ctggtaaaatatgttcatgctattcg |
29115158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 35
Target Start/End: Complemental strand, 19237634 - 19237606
Alignment:
| Q |
7 |
gatgagataatgcacccaaattcaaaagt |
35 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19237634 |
gatgagataatgcacccaaattcaaaagt |
19237606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University