View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9526_low_26 (Length: 249)
Name: NF9526_low_26
Description: NF9526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9526_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 15 - 232
Target Start/End: Complemental strand, 37865340 - 37865123
Alignment:
| Q |
15 |
caaagggtatgagatattatcaattcgattgcaagaaatagttttagagctgaatattgtaaatttgagaggttttaccaagtttaagaaagttaatatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37865340 |
caaagggtatgagatattatcaattcgattgcaagaaatagttttagagctgaagattgtaaatttgagaggttttaccaagtttaagaaagttaatatc |
37865241 |
T |
 |
| Q |
115 |
agtttcattaatgattcatagcacagtgttgcggccaaccttgcatgaactgataatggctatgtcaacgaagcatggcttgagagggaagttgaatgga |
214 |
Q |
| |
|
||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37865240 |
agtatcattaatgattcatagcacagtgttgcagccaaccttgcatgaactgataatggctatgtcaacgaagcatggcttgagagggaagttgaatgga |
37865141 |
T |
 |
| Q |
215 |
actaagaagaaaataagt |
232 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
37865140 |
actaagaagaaaataagt |
37865123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University