View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9527_low_17 (Length: 351)
Name: NF9527_low_17
Description: NF9527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9527_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 4e-63; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 18 - 169
Target Start/End: Complemental strand, 54602038 - 54601887
Alignment:
| Q |
18 |
tgtttaaactggaataataaactagaaaaatttagatatcattattctagaaatggttcgaattctttcataagagttgaaatctttactattgattaga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54602038 |
tgtttaaactggaataataaactagaaaaatttagatatcattattctagaaacggttcgaattctttcataagagttgaaatctttactattgattaga |
54601939 |
T |
|
| Q |
118 |
ctacgtgatatannnnnnngacaacaattgtatttaccgtggaggtatttga |
169 |
Q |
| |
|
| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54601938 |
cgacgtgatatattttcttgacaacaattgtatttaccgtggaggtatttga |
54601887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 207 - 273
Target Start/End: Complemental strand, 54601856 - 54601790
Alignment:
| Q |
207 |
aatggagagaaaagaacctttcgggtggtccaagttatgaaaatggcagtataagaatcatgggccg |
273 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54601856 |
aatggaaagaaaagaacctttcgggtggtccaagttatgaaaatggcagtataagaatgatgggccg |
54601790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 295 - 343
Target Start/End: Complemental strand, 54601802 - 54601754
Alignment:
| Q |
295 |
gaatcatgggccggggcgccgggctaagcccagtccttacagaacacga |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54601802 |
gaatgatgggccggggcgccgggctaagcccagtccttacagaacacga |
54601754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University