View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9527_low_30 (Length: 249)

Name: NF9527_low_30
Description: NF9527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9527_low_30
NF9527_low_30
[»] chr7 (1 HSPs)
chr7 (9-131)||(43070511-43070633)
[»] chr5 (3 HSPs)
chr5 (9-131)||(7472637-7472759)
chr5 (9-131)||(9044674-9044795)
chr5 (9-131)||(30441674-30441796)
[»] chr2 (3 HSPs)
chr2 (9-131)||(23348109-23348231)
chr2 (9-131)||(18354436-18354558)
chr2 (9-68)||(12742559-12742618)
[»] chr3 (4 HSPs)
chr3 (89-177)||(50829321-50829409)
chr3 (89-177)||(50846444-50846532)
chr3 (18-64)||(50829466-50829512)
chr3 (18-64)||(50846341-50846387)


Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 9 - 131
Target Start/End: Complemental strand, 43070633 - 43070511
Alignment:
Q  9 tggtggtgctgtgcaggtttttggtggtttcagggtgctgtcatggtgttgttggcagtttagttgttggtttcagctattggctggcatctagagggtt 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||  ||||| ||||||| ||||||    
T  43070633 tggtggtgctgtgcaggtttttggtggtttcagggtgctgtcatggtgctgttggcagtttagttgttggtttcagctgctggctagcatctatagggtt 43070534  T
Q  109 ggcggttgcagctgtttggatct 131  Q
    |||||||||||||||||||||||    
T  43070533 ggcggttgcagctgtttggatct 43070511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 9 - 131
Target Start/End: Complemental strand, 7472759 - 7472637
Alignment:
Q  9 tggtggtgctgtgcaggtttttggtggtttcagggtgctgtcatggtgttgttggcagtttagttgttggtttcagctattggctggcatctagagggtt 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||  ||||| ||||||| ||||||    
T  7472759 tggtggtgctgtgcaggtttttggtggtttcagggtgctgtcatggtgctgttggcagtttagttgttggtttcagctgctggctagcatctatagggtt 7472660  T
Q  109 ggcggttgcagctgtttggatct 131  Q
    |||||||||||||||||||||||    
T  7472659 ggcggttgcagctgtttggatct 7472637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 9 - 131
Target Start/End: Original strand, 9044674 - 9044795
Alignment:
Q  9 tggtggtgctgtgcaggtttttggtggtttcagggtgctgtcatggtgttgttggcagtttagttgttggtttcagctattggctggcatctagagggtt 108  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||  ||||||||||||| ||||||    
T  9044674 tggtggtgctgtgcaggtttt-ggtggtttcagggtgctgtcatggtgctgttggcagtttagttgttggtttcagctgctggctggcatctatagggtt 9044772  T
Q  109 ggcggttgcagctgtttggatct 131  Q
     ||||||||||||||||||||||    
T  9044773 agcggttgcagctgtttggatct 9044795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 9 - 131
Target Start/End: Complemental strand, 30441796 - 30441674
Alignment:
Q  9 tggtggtgctgtgcaggtttttggtggtttcagggtgctgtcatggtgttgttggcagtttagttgttggtttcagctattggctggcatctagagggtt 108  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||  ||||| ||||||| ||||||    
T  30441796 tggtggtgttgtgcaggtttttggtggtttcagggtgctgtcatggtgttgttggcattttagttgttggtttcagctgctggctagcatctatagggtt 30441697  T
Q  109 ggcggttgcagctgtttggatct 131  Q
    ||| |||||||||||||||||||    
T  30441696 ggcagttgcagctgtttggatct 30441674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 9 - 131
Target Start/End: Complemental strand, 23348231 - 23348109
Alignment:
Q  9 tggtggtgctgtgcaggtttttggtggtttcagggtgctgtcatggtgttgttggcagtttagttgttggtttcagctattggctggcatctagagggtt 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||  ||||| ||||||| ||||||    
T  23348231 tggtggtgctgtgcaggtttttggtggtttcagggtgctgtcatggtgctgttggcagtttagttgttggtttcagctgctggctagcatctatagggtt 23348132  T
Q  109 ggcggttgcagctgtttggatct 131  Q
    |||||||||||||||||||||||    
T  23348131 ggcggttgcagctgtttggatct 23348109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 9 - 131
Target Start/End: Complemental strand, 18354558 - 18354436
Alignment:
Q  9 tggtggtgctgtgcaggtttttggtggtttcagggtgctgtcatggtgttgttggcagtttagttgttggtttcagctattggctggcatctagagggtt 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||  ||||| | ||||| ||||||    
T  18354558 tggtggtgctgtgcaggtttttggtggtttcagggtgctgtcatggtgctgttggcagtttagttgttggtttcagctgctggcttggatctatagggtt 18354459  T
Q  109 ggcggttgcagctgtttggatct 131  Q
    |||||||||||||||||||||||    
T  18354458 ggcggttgcagctgtttggatct 18354436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 9 - 68
Target Start/End: Original strand, 12742559 - 12742618
Alignment:
Q  9 tggtggtgctgtgcaggtttttggtggtttcagggtgctgtcatggtgttgttggcagtt 68  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||    
T  12742559 tggtggtgctgtgcaggtttttggtggtttcagggtgttgtcatggtgctgttggcagtt 12742618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 89 - 177
Target Start/End: Complemental strand, 50829409 - 50829321
Alignment:
Q  89 tggctggcatctagagggttggcggttgcagctgtttggatcttttctgcagctgtcagttgggttagcagctgatgtccaccgttttt 177  Q
    ||||||||||||||||||||||||||||||||||||||| | |||||||| |||||||| |||||||||||||  ||||||||||||||    
T  50829409 tggctggcatctagagggttggcggttgcagctgtttggctgttttctgcggctgtcagctgggttagcagctactgtccaccgttttt 50829321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 89 - 177
Target Start/End: Original strand, 50846444 - 50846532
Alignment:
Q  89 tggctggcatctagagggttggcggttgcagctgtttggatcttttctgcagctgtcagttgggttagcagctgatgtccaccgttttt 177  Q
    ||||||||||||||||||||||||||||||||||||||| | |||||||| |||||||| |||||||||||||  ||||||||||||||    
T  50846444 tggctggcatctagagggttggcggttgcagctgtttggctgttttctgcggctgtcagctgggttagcagctactgtccaccgttttt 50846532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 50829512 - 50829466
Alignment:
Q  18 tgtgcaggtttttggtggtttcagggtgctgtcatggtgttgttggc 64  Q
    |||||||||||||||||||||| || |||| |||||||| |||||||    
T  50829512 tgtgcaggtttttggtggtttcgggctgctatcatggtgctgttggc 50829466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 64
Target Start/End: Original strand, 50846341 - 50846387
Alignment:
Q  18 tgtgcaggtttttggtggtttcagggtgctgtcatggtgttgttggc 64  Q
    |||||||||||||||||||||| || |||| |||||||| |||||||    
T  50846341 tgtgcaggtttttggtggtttcgggctgctatcatggtgctgttggc 50846387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University