View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9527_low_33 (Length: 246)
Name: NF9527_low_33
Description: NF9527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9527_low_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 24811994 - 24811764
Alignment:
| Q |
1 |
ctcaagtcaatgaaatggctcagttgttttccgatttcgttgatggctgtctatccgttccgatcaacatccctggatcttcataccacactgctatgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24811994 |
ctcaagtcaatgaaatggctcagttgttttccgatttcgttgatggctgtctatctgttccgatcaacatccctggctcttcataccacactgctatgaa |
24811895 |
T |
|
| Q |
101 |
ggtacgatgagtaaacttttagaccaaagatatataaagagaatagaattgcaaaaagaaaataaaagagcgttaagaagttggtannnnnnnagctaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
24811894 |
ggtacgatgagtaaacttttagaccaaagatatataaagagaatagaattgcaaaaagaaaacaaaagagcgttaagaagttggtatttttttagctaca |
24811795 |
T |
|
| Q |
201 |
taacgttgaactacatttcaaagaaattagt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24811794 |
taacgttgaactacatttcaaagaaattagt |
24811764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University