View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9527_low_35 (Length: 228)
Name: NF9527_low_35
Description: NF9527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9527_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 74 - 215
Target Start/End: Original strand, 32790582 - 32790717
Alignment:
| Q |
74 |
gagtagtacctacttccatgggtctgcgactgcgaccatccaagcgaagtccttctgggctcacgtattccattttttggttttcaaattcaaataaatt |
173 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| | |
|
|
| T |
32790582 |
gagtagtacctacttccatgggtctgc------gaccatccaagcgaagtccttctgggctcacgtattccattttttggtgttcaaattcaaaaaaaat |
32790675 |
T |
|
| Q |
174 |
tgtgaaggcattgttgttttgcgatactttgtcctttgcttc |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32790676 |
tgtgaaggcaatgttgttttgcgatactttgtcctttgcttc |
32790717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University