View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9527_low_40 (Length: 218)
Name: NF9527_low_40
Description: NF9527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9527_low_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 20 - 195
Target Start/End: Complemental strand, 11599449 - 11599274
Alignment:
| Q |
20 |
ctaaatgaagaaataattaaaatgaaaatccttgatttggcccacatgggatcacgaactagatggattcttcttttccaaatatggaaggactttaatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11599449 |
ctaaatgaagaaataattaaaatgaaaatccttgatttggcccacatgggatcacgaactagatagattcttcttttccaaatatggaagtactttaatt |
11599350 |
T |
|
| Q |
120 |
aaaatttactaatatcccatactttcggagaaaactttgatgctttttatattgcatgcatctgtccacatgttat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11599349 |
aaaatttactaatatcccatactttcggagaaaactttgatgctttttatattgcatgcatctgtccacatgttat |
11599274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University