View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9528_low_15 (Length: 253)
Name: NF9528_low_15
Description: NF9528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9528_low_15 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 114 - 253
Target Start/End: Original strand, 28612718 - 28612857
Alignment:
| Q |
114 |
ttaatttgttttgcttattnnnnnnnngttgttggctcaaattctatattggcatattgtttctgtcattcattggggtgtgaaattgcatcgaatgagg |
213 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28612718 |
ttaatttgttttgcttattaaaaaaaagttgttggctcaaattctatattggcatattgtttctgtcattcattggggtgtgaaattgcatcgaatgagg |
28612817 |
T |
|
| Q |
214 |
aggtctttctggtaggaggaagagcattttcagaatctta |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28612818 |
aggtctttctggtaggaggaagagcattttcagaatctta |
28612857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 12 - 82
Target Start/End: Original strand, 28612651 - 28612718
Alignment:
| Q |
12 |
gattatactctagtcttttctaggttatcttatagggtgtgtatgtttctgctgtctgtacacattttagt |
82 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28612651 |
gattatactctagtcttttctaggctatct---agggtgtgtatgtttctgctgtctgtacgcattttagt |
28612718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 166 - 217
Target Start/End: Original strand, 28611929 - 28611980
Alignment:
| Q |
166 |
catattgtttctgtcattcattggggtgtgaaattgcatcgaatgaggaggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
28611929 |
catattgtttctgtcattcattggggtgccaaattgcatccaatgaggaggt |
28611980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University