View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9528_low_16 (Length: 250)
Name: NF9528_low_16
Description: NF9528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9528_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 221
Target Start/End: Original strand, 46151173 - 46151375
Alignment:
| Q |
19 |
aaaatggagttgttctggtctcgttctcctccttctagcggtggttgccttgttttaggatcaggggtgttttgtccttgaagctgcgttctgggtttga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46151173 |
aaaatggagttgttctggtctcgttctcctccttctagcggtggttgccttgttttaggatcaggggtgttttgtccttgaagctgcgttctgggtttga |
46151272 |
T |
|
| Q |
119 |
atcttgttttgtgattggattcgctcagatttgcgaattttctcaacgtttatgcgattgatgctgggttctgttttaaaaccactggttgtcctttgct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| | |
|
|
| T |
46151273 |
atcttgttttgtgattggattcgctcagatttgcgaattttctcaacgtttatgcgattgatgctgggttctgttttaaaaccaccggctgtcctttgtt |
46151372 |
T |
|
| Q |
219 |
tct |
221 |
Q |
| |
|
||| |
|
|
| T |
46151373 |
tct |
46151375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 19 - 221
Target Start/End: Original strand, 45991290 - 45991487
Alignment:
| Q |
19 |
aaaatggagttgttctggtctcgttctcctccttctagcggtggttgccttgttttaggatcaggggtgttttgtccttgaagctgcgttctgggtttga |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45991290 |
aaaatggagttgttctaatctcgttctcctccttctagcggtggttgccttgttttaggataagggttgttttgtccttgaagctgcgttctgggtttg- |
45991388 |
T |
|
| Q |
119 |
atcttgttttgtgattggattcgctcagatttgcgaattttctcaacgtttatgcgattgatgctgggttctgttttaaaaccactggttgtcctttgct |
218 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45991389 |
----tgtgttgtgattggattcgctcagatttgcgaattttctcaacgtttctgcgattgatgctgggttctgttttaaaaccactggttgtcctttgtt |
45991484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University