View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9528_low_18 (Length: 243)
Name: NF9528_low_18
Description: NF9528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9528_low_18 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 38923294 - 38923074
Alignment:
| Q |
18 |
taaacttggacgaagaagtaaatattaatttaacaactaacgaattgaaagattacttattcatccaaatta---agttgtttctttctcttacccaaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38923294 |
taaacttggacgaagaagtaaatattaatttaacaa--------ttgaaagattacttattcatccaaattattaagttgtttctttctcttacccaaaa |
38923203 |
T |
|
| Q |
115 |
gttgagttgaacggatcttagtttgtattgctatataacaatcattttggcatattacgtatgatttttgtcgctaaatagtcattgattttaattggta |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
38923202 |
gttgagttgaacggatcttagtttgtattgctatataacaatcattttggcatattacgtatgatttttgttgctaaatagtcattgattttaactggta |
38923103 |
T |
|
| Q |
215 |
taactattcagttataatagagtactttt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38923102 |
taactattcagttataatagagtactttt |
38923074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University