View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9528_low_19 (Length: 230)
Name: NF9528_low_19
Description: NF9528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9528_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 39793456 - 39793254
Alignment:
| Q |
18 |
gatgttaaatatcaaaccttacgtgttgtagtgcagtggtaggtactactgagacatgtctatgagtttgatcccataacaatcaatcagagcaaactaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
39793456 |
gatgttaaatatcaaaccttacgtgttgtagtgcagtggtaggtgctattgagacatgtctatgagtttgatcccataacaatcaatcagagccaaccaa |
39793357 |
T |
|
| Q |
118 |
acacatattgaagtctaaggcgaattttatgatgaggttcttttgaagttcataataatatttttttattnnnnnnnnntatattttatttattttagta |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
39793356 |
acatatattgaagtctaaggcgaattttatgatgaggttcttttgaagttcataataatatt-ttttattaaataaaaatatattttatttattttagta |
39793258 |
T |
|
| Q |
218 |
taat |
221 |
Q |
| |
|
|||| |
|
|
| T |
39793257 |
taat |
39793254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University