View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9528_low_7 (Length: 331)
Name: NF9528_low_7
Description: NF9528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9528_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 19 - 313
Target Start/End: Original strand, 36344209 - 36344503
Alignment:
| Q |
19 |
acttgggatgataaatcaaaatatattttgtgactattgcaactattgcaatccaagagccccctatccccgctgacaagcttagattcctcgcagttac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36344209 |
acttgggatgataaatcaaaatatattttgtgactattgcaactattgcaatccaagagccccctatccccgctgacaagcttagattcctcgcagttac |
36344308 |
T |
|
| Q |
119 |
gataacccctctttatttagtcacataatcttattcgtttaatcttaatcggatggctctaaaacataatatttagtcgtttaatcttaatcggatgact |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36344309 |
gataacccctctttatttagtcacataatcttagtcgtttaatcttaatcggatggctctaaaacataatatttagtcgtttaatcttaataggatgact |
36344408 |
T |
|
| Q |
219 |
ctaaaacataccatcaaaatgtgaaacatctaaatataaccggattgtccaaattcgcaacagcgtgattcaatgagtgtaagctattccctttg |
313 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
36344409 |
ctaaaacataccattaaaatgtgaaacgtctaaatataaccggattgtccaaattcgcaacagcgtgattgaatgagtttaagctattccctttg |
36344503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University