View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9529_low_21 (Length: 224)
Name: NF9529_low_21
Description: NF9529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9529_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 33815073 - 33815279
Alignment:
| Q |
1 |
aagacaaataaaaacaacacatatcaaatcatcttctaaaatgaagtagctacattcaatagtccatttttctgagacatgtcaaaattttaatcaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33815073 |
aagacaaataaaaacaacacatatcaaatcatcttctaaaatgaagtagctacattcaatagtccatttttctgagacatgtcaaaattttaatcaattt |
33815172 |
T |
|
| Q |
101 |
gttgagcaatgttaatcagattatgcataaaccctaaacattgtcaagttttgaataatgtcactggttcaatgtgactgagtttcctgcatatggaagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33815173 |
gttgagcaatgttaatcagattatgcataaaccctaaacattgtcaagttttgaataatgtcactggttcaatgtgactgagtttcctgcatatggaagc |
33815272 |
T |
|
| Q |
201 |
ttgaagg |
207 |
Q |
| |
|
||||||| |
|
|
| T |
33815273 |
ttgaagg |
33815279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University