View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9529_low_9 (Length: 307)
Name: NF9529_low_9
Description: NF9529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9529_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 11 - 291
Target Start/End: Complemental strand, 11869124 - 11868843
Alignment:
| Q |
11 |
cacagactcgcggctgagagcttttgtgaacttcaccatctgctcactcactgaatcaggctgagtttgcaccaagcactgtacagtttcaacattttct |
110 |
Q |
| |
|
||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11869124 |
cacagactcgcggctgatagtttttgcgaacttcaccatctgctcactcactgaatcaggctgagtttgcaccaagcactgtacagtttcaacattttct |
11869025 |
T |
 |
| Q |
111 |
ctgaggactaaaaacgccatcttcttactcactggtcgtat-gtttgtaccctcccttgaattctaactgaattattcaccggtgaatcgtcaagtgctt |
209 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11869024 |
ttgaggactaaaaacgccaacttcttactcactggtcgtatagtttgtaccctccctcaaattctaactgaattattcaccagtgaatcgtcaagtgctt |
11868925 |
T |
 |
| Q |
210 |
tgacctgggtccgggggacaggatggaccggtgtcttcgattgcagctcctttaacgggatgtcgccataattggtggctaa |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11868924 |
cgacctgggtccgggggacaggatggaccggtgtcttcgattgcagctcctttaacgggatgtcgccataattggtggctaa |
11868843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 42 - 136
Target Start/End: Complemental strand, 3103655 - 3103561
Alignment:
| Q |
42 |
ttcaccatctgctcactcactgaatcaggctgagtttgcaccaagcactgtacagtttcaacattttctctgaggactaaaaacgccatcttctt |
136 |
Q |
| |
|
|||||||||||| ||| ||| ||||||| || | || |||||||||||||| || | |||||||||||| |||||| |||||||||||||| |
|
|
| T |
3103655 |
ttcaccatctgcggacttactaaatcaggttgtgcctgaaccaagcactgtacggtgaaaccattttctctgatgactaagaacgccatcttctt |
3103561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University