View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9530_low_8 (Length: 349)
Name: NF9530_low_8
Description: NF9530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9530_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 1e-35; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 159 - 239
Target Start/End: Original strand, 12553277 - 12553357
Alignment:
| Q |
159 |
tatatatatagacacacacatacatgcatgtgtgtgtagcttttgaaaagagaaaaacttacaatgtcttccattaaatct |
239 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12553277 |
tatatatatagacacgcacatacatgcatgtgtgtgtagcttttgaaaagagaaaaacttacaatgtcttccattaaatct |
12553357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 271 - 341
Target Start/End: Original strand, 12553388 - 12553458
Alignment:
| Q |
271 |
gcagcttgacatccacttctgcgtcacaaatttcgtggtagaggaataattgattatctttgagaataatc |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12553388 |
gcagcttgacatccacttctgcgtcacaaatttcgtggtagaggaataattgattatctttgagaataatc |
12553458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 110 - 168
Target Start/End: Original strand, 12553162 - 12553220
Alignment:
| Q |
110 |
gcaatgaacttttatattttgcaaaatgcaaacaatatggtcatgagggtatatatata |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12553162 |
gcaatgaacttttatattttgcaaaatgcaaacaatatggtcatgagggtatatatata |
12553220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University