View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9531_high_5 (Length: 221)
Name: NF9531_high_5
Description: NF9531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9531_high_5 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 12 - 221
Target Start/End: Original strand, 40084515 - 40084724
Alignment:
| Q |
12 |
attatactgcatacacagtgaacttctctctggaattacagccgttggactaatctcaattccagttaaataattatgctgcaaatataatatctgtatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40084515 |
attatactgcatacacagtgaacttctctctggaattacagccgttggactaatctcaattccagttaaataattatgctgcaaatataatatctgtatg |
40084614 |
T |
|
| Q |
112 |
cttgcatccaataaccgctccacaaaactagccggtacccgacccgtgaaccggttgttattcaggtaaagattctgcacattggccagcataggtgata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40084615 |
cttgcatccaataaccgctccacaaaactagccggtacccgacccgtgaaccggttgttattcaggtaaagattctgcacattggccagcataggtgata |
40084714 |
T |
|
| Q |
212 |
tttgaccaga |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
40084715 |
tttgaccaga |
40084724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 52 - 104
Target Start/End: Original strand, 37408096 - 37408148
Alignment:
| Q |
52 |
gccgttggactaatctcaattccagttaaataattatgctgcaaatataatat |
104 |
Q |
| |
|
||||||||| ||||| | ||||| || | |||||||||||||||||||||||| |
|
|
| T |
37408096 |
gccgttggattaatcacgattccggtgagataattatgctgcaaatataatat |
37408148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University