View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9531_low_14 (Length: 233)
Name: NF9531_low_14
Description: NF9531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9531_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 43527820 - 43528023
Alignment:
| Q |
18 |
attatcaggtttctttcgtcgcacttcctcactcttaatggtgggtaacttcttcct--gttactgccatcaacaatggtcgcatatatgtgtctcatca |
115 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43527820 |
attatcaagtttctttcgtcccacttcctcactcttaacggtgggtaacttcttcctctgttactgccatcaacaatggtcgcatatatgtgtctcatca |
43527919 |
T |
|
| Q |
116 |
agcacacactagctaggactctaaaatttaccacctcccatgcatacattgaaattgacttgaacactgaagctatatatgcaaataccccaaccctacc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43527920 |
agcacacactagctaggactctaaaatttaccacctcccatgcatacattgaaattgacttgaacactgaagctatatatgcaaataccccaaccctacc |
43528019 |
T |
|
| Q |
216 |
tatg |
219 |
Q |
| |
|
|||| |
|
|
| T |
43528020 |
tatg |
43528023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University