View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9531_low_17 (Length: 217)
Name: NF9531_low_17
Description: NF9531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9531_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 19750946 - 19750752
Alignment:
| Q |
1 |
taaaaagctaataagatatgtagaagtcccatatctacacagtcgatctctctcattccaatgtgatttgctttattcatgtgtcctctgcctagaaaca |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19750946 |
taaaaagctaataagatatgcagaagtcccatatctacacagttgatctctctcattccaatgtgatttgctttattcatgtgtcctctgcctagaaaca |
19750847 |
T |
|
| Q |
101 |
tgtcaggagccactgtttgcatgtgtcacattcatcgacgatcattcaccacccatgtcggcctcaggtgtcacaatatgccatattgaagaaat |
195 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19750846 |
tgccaggagccactgtttgcatgtgtcacattcatcgacgatcattcaccacccatgtcggcctcaggtgtcacaatatgccatattgaagaaat |
19750752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 19596448 - 19596488
Alignment:
| Q |
1 |
taaaaagctaataagatatgtagaagtcccatatctacaca |
41 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
19596448 |
taaaaaactaataacatatgtagaagtcccatatctacaca |
19596488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University