View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9532_high_8 (Length: 308)
Name: NF9532_high_8
Description: NF9532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9532_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 298
Target Start/End: Original strand, 277286 - 277562
Alignment:
| Q |
19 |
ttgaggaccccatcggaggatcgtggtagaacctttccaccataactgcaaaggaattttactttattctttggagattcgtcccctgttttctccatcn |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
277286 |
ttgaggaccccatcggaggatcgtggtagaacctttccaccataactgcaaaggaattttactttattctttggagattcgtcccctgttttctccatct |
277385 |
T |
 |
| Q |
119 |
nnnnnnnnnnnnnnnnnntgtttctctctacccctcaaaagtgtaagaatggagagtgattttgggatgaaagtaaaggatatagatagattagatcaga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
277386 |
attattattattatt---tgtttctctctacccctcaaaagtgtaagaatggagagtgattttgggatgaaagtaaaggatatagatagattagatcaga |
277482 |
T |
 |
| Q |
219 |
tcataggaatggataaatatagtttgctatttctgtgctttcatctttatcctatttattattattagcatttctctctg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
277483 |
tcataggaatggataaatatagtttgctatttctgtgctttcatctttatcctatttattattattagcatttctctctg |
277562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University