View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9532_low_17 (Length: 405)
Name: NF9532_low_17
Description: NF9532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9532_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 219 - 380
Target Start/End: Original strand, 28966552 - 28966713
Alignment:
| Q |
219 |
gtgggtcggtcactaggaaaaagcgtgtcctaaccgatgattaatcagtaaccattgttagaagaattgtcacaaagggacaagaaaaagaaagctaaaa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28966552 |
gtgggtcggtcactaggaaaaagcgtgtcctaaccgatgattaatcagtaaccattattagaagaattgtcacaaaaggacaagaaaaagaaagctaaaa |
28966651 |
T |
 |
| Q |
319 |
attaggtcacaatacaatagttgggagttctgagttcatattcaggttaaaggaatgattta |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28966652 |
attaggtcacaatacaatagttgggagttctgagttcatattcaggttaaaggaatgattta |
28966713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 8 - 122
Target Start/End: Original strand, 28966341 - 28966455
Alignment:
| Q |
8 |
ttggtgttggtggtagggtcagcattagccattagcaatacaaagaaaggacgtacaccattatttttccagggtggagcacatgatacaagttatgcaa |
107 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28966341 |
ttggtgttgatggtagggtcagcattagccattagcaatacaaagaaaggacgtacaccattatttttccagggtggagcacatgatacaagttgtgcaa |
28966440 |
T |
 |
| Q |
108 |
aatatatgatactat |
122 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
28966441 |
aatatatgatactat |
28966455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University