View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9532_low_32 (Length: 306)
Name: NF9532_low_32
Description: NF9532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9532_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 12 - 290
Target Start/End: Complemental strand, 12505286 - 12505008
Alignment:
| Q |
12 |
tgttgtcgaagaggatcggaaacgatgaagcatctaagagtgctatgactcttgggtttgaggaaatgaatggacctggtggcatgttggttttgaagac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12505286 |
tgttgtcgaagaggatcggaaacgatgaagcatctaagagtgctatgactcttgggtttgaggaaatgaatggacctggtggcatgttggttttgaagac |
12505187 |
T |
|
| Q |
112 |
tgttgaattgtatttttgaattctagttgagaagaatttgtctctgcctttgttgtagaaaaagtcatgtcggtccaaaatcggtccgatgaaagggagg |
211 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12505186 |
tgttgaattgtatttttgtattcttgttgagaagaatttgtctctgccttggttatagaaaaagtcatgtcggtccaaaatcggtccgatgaaagggagg |
12505087 |
T |
|
| Q |
212 |
ccataggttcctgggatttcttttagtggaagctcttgctggtgattgttgatggtggtggaagattgtggtgaagatg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12505086 |
ccataggttcctgggatttcttttagtggaagctcttgctggtgattgctgatggtggtggaagattgtggtgaagatg |
12505008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 12 - 248
Target Start/End: Complemental strand, 12490741 - 12490505
Alignment:
| Q |
12 |
tgttgtcgaagaggatcggaaacgatgaagcatctaagagtgctatgactcttgggtttgaggaaatgaatggacctggtggcatgttggttttgaagac |
111 |
Q |
| |
|
||||||||||||| ||||| || |||| || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
12490741 |
tgttgtcgaagagtatcgggaaagatgcggcgtctaagagtgctatgactcttgggtttgaggaaatgaagggacctggtggcatgttggttctgaagat |
12490642 |
T |
|
| Q |
112 |
tgttgaattgtatttttgaattctagttgagaagaatttgtctctgcctttgttgtagaaaaagtcatgtcggtccaaaatcggtccgatgaaagggagg |
211 |
Q |
| |
|
|||||| ||||||||||| ||||| |||||||||||||||||||| |||| ||||||||| |||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
12490641 |
tgttgagttgtatttttggattcttgttgagaagaatttgtctcttccttggttgtagaagtagtcgtgtcggtcgaagatcggtccgatgaaagggagg |
12490542 |
T |
|
| Q |
212 |
ccataggttcctgggatttcttttagtggaagctctt |
248 |
Q |
| |
|
|||||| | |||||||||| ||||||||| ||||||| |
|
|
| T |
12490541 |
ccatagctgcctgggatttgttttagtgggagctctt |
12490505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University