View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9532_low_35 (Length: 301)
Name: NF9532_low_35
Description: NF9532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9532_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 246
Target Start/End: Original strand, 47908966 - 47909206
Alignment:
| Q |
7 |
ggatgagaaaataaatatatttatgtctgtttatttattgtgctttggcacaattgaaatgtttgtattaagttttagaattaggtccaattataattga |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47908966 |
ggatgagaaaataaatatatttatgttgttttatttattgtggtttggcacaattgaaatgtttgtattaagttttagaattaggtccaattataattga |
47909065 |
T |
|
| Q |
107 |
aatgctttattggattgcatatcctcagatatgcatggagacctctcaaataacttcattttcaaaattcaaagtcggtggaatttccattttctactcg |
206 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47909066 |
aatgccttattggattgcatatcctcagatatgcatagagacctcgcaaataacttcattttcaaaattcaaagtcggtggaatttccattttctactcg |
47909165 |
T |
|
| Q |
207 |
c-aaatgttgaataaatttctcattctaataaataaataaa |
246 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47909166 |
caaaatgttgaataaatttctcattctaataaataaataaa |
47909206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University