View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9532_low_50 (Length: 246)
Name: NF9532_low_50
Description: NF9532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9532_low_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 39291541 - 39291306
Alignment:
| Q |
1 |
ctccgacaacaaaatcatttctttttggtctttaaggaagatgagcctaacttgctcgaaaacatttgtgtgtaactggtgcccctaaatgttacttttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39291541 |
ctccgacaacaaaatcatttctttttggtctttaaggaagatgagcctaactcactcgaaaacatttgtgtgtaactggtgcccctaaatgttacttttc |
39291442 |
T |
|
| Q |
101 |
aaatgatttttgaaattgaccttttagatcagaataaatataagaaacgaaacgtattcgagcaaaccaagcagttattgttaacttcg-taagatttga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
39291441 |
aaatgatttttgaaattgaccttttagatcagaataaatataagaaacgaaacgtattcgagcaaaccaagaagttattgttaacttcgcaaagatttga |
39291342 |
T |
|
| Q |
200 |
aacgttttggattatgttatgattacgtttatcctct |
236 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39291341 |
aacg-tttggattatgttatgattacgtttatcctct |
39291306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University