View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9532_low_75 (Length: 212)
Name: NF9532_low_75
Description: NF9532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9532_low_75 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 28 - 184
Target Start/End: Original strand, 17658682 - 17658838
Alignment:
| Q |
28 |
ctataacaggaaattgaattgatcttattggaattttaggtgggttggatgtatggaacaatgacagaagatatactaactgggttgacgatacacaaaa |
127 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
17658682 |
ctataacaggaaattggattgatcttgttggaattttaggtgggttggatgtatggaacaatgactgaagatatactaactgggctgacgatacacaaaa |
17658781 |
T |
|
| Q |
128 |
aaggttggagatcggaattatgtacaccggatccaatagccttcacaggttctgctc |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17658782 |
aaggttggagatcggaattatgtacaccggatccaatagccttcacaggttgtgctc |
17658838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University