View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_high_7 (Length: 379)
Name: NF9533A_high_7
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 21 - 356
Target Start/End: Complemental strand, 35496594 - 35496263
Alignment:
| Q |
21 |
atcacatatataaacaattagtagtgccgttgcatcatcctattgaacttgtacaagtattttattgaattttatcgggttaatatagctcagtctaata |
120 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35496594 |
atcacatatataaacaattattagtgccgttgcatcatcctattgaacttgtacaagtactttattgaattttatcaggttaatatagctcagtctaata |
35496495 |
T |
 |
| Q |
121 |
ttagggtcggataagatataaacaaccttacctaattcgtcttccgtacgtcattacttcatctaacaaaaatgaattggtaccgattatattctacctt |
220 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||| |||||||| |||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35496494 |
ttagggtcggataagatataaataactttacctaattcgtctttcgtacgtcgttacttcatccaacgaaaatgaattggtaccgattatattctacctt |
35496395 |
T |
 |
| Q |
221 |
aaatatgttaggtttacnnnnnnnnnnnnaatatatgttaggtttagtgatgagaacacaactatgtttatctcactccnnnnnnngtttggatggaatt |
320 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35496394 |
aaatatgttaggtttac----tttttattaatatatgttaggtttagtgatgagaacacaactatgtttatctcactcctttttttgtttggatggaatt |
35496299 |
T |
 |
| Q |
321 |
tatctcactcccatagctagtagttagcaattttat |
356 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35496298 |
tatctcactcccatagctagtagttagcacttttat |
35496263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University