View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_103 (Length: 284)
Name: NF9533A_low_103
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_103 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 134 - 254
Target Start/End: Complemental strand, 1985651 - 1985531
Alignment:
| Q |
134 |
aatatattgtgtgattattttcaaatcatggttttatttgataatcattttgccctcaagtttaattatttgttttgtattgagtttaaatattggtaac |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1985651 |
aatatattgtgtgattattttcaaatcatggttttatttgataatcattttgccctcaagtttaattatttgttttgtattgagtttaaatattggcaac |
1985552 |
T |
 |
| Q |
234 |
aatgcactttgatgtgtatgg |
254 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1985551 |
aatgcactttgatgtgtatgg |
1985531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 76; Significance: 3e-35; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 134 - 246
Target Start/End: Complemental strand, 6934932 - 6934824
Alignment:
| Q |
134 |
aatatattgtgtgattattttcaaatcatggttttatttgataatcattttgccctcaagtttaattatttgttttgtattgagtttaaatattggtaac |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| ||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
6934932 |
aatatattgtgtgattattttcaaatcatggttttatttgataatcagttttccctcaagt----ttatttgttttgtcttgcgtttaaatattggtaac |
6934837 |
T |
 |
| Q |
234 |
aatgcactttgat |
246 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
6934836 |
aatgaactttgat |
6934824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 134 - 197
Target Start/End: Complemental strand, 6947527 - 6947464
Alignment:
| Q |
134 |
aatatattgtgtgattattttcaaatcatggttttatttgataatcattttgccctcaagttta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6947527 |
aatatattgtgtgattattttcaaatcatggttttatttgataatcattttgccctcaagttta |
6947464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 223 - 260
Target Start/End: Complemental strand, 6947453 - 6947416
Alignment:
| Q |
223 |
atattggtaacaatgcactttgatgtgtatggtacaat |
260 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6947453 |
atattggtaacaatgaactttgatgtgtatggtacaat |
6947416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University