View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_136 (Length: 251)
Name: NF9533A_low_136
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_136 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 39 - 239
Target Start/End: Original strand, 23332595 - 23332795
Alignment:
| Q |
39 |
atatgtggacgaatgagcgatagaagcgcatgaccgatccaccctcacgttggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
138 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332595 |
atatatggacgaatgagcgatagaagcgcatgaccgatccaccctcacgtgggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
23332694 |
T |
 |
| Q |
139 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacataagtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332695 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacatacgtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
23332794 |
T |
 |
| Q |
239 |
a |
239 |
Q |
| |
|
| |
|
|
| T |
23332795 |
a |
23332795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 2 - 44
Target Start/End: Original strand, 23322331 - 23322373
Alignment:
| Q |
2 |
gacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
44 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
23322331 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23322373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 2 - 44
Target Start/End: Original strand, 23332498 - 23332540
Alignment:
| Q |
2 |
gacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
44 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
23332498 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23332540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University