View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_151 (Length: 248)
Name: NF9533A_low_151
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_151 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 103 - 227
Target Start/End: Complemental strand, 56334062 - 56333938
Alignment:
| Q |
103 |
aacaatggtttcacttataaaaatgctatcaaacattctaatcttgcccgctaatggtccaaacgttcagagctatccaattcttggcttcttgatactg |
202 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56334062 |
aacaagggtttcacttataaaaatgctatcaaacattctaatcttgcccgctaatggtccaaacgttcagagctatccaattcttggcttcttgatactg |
56333963 |
T |
 |
| Q |
203 |
cagccagggcccttgtattgcttga |
227 |
Q |
| |
|
|||||||||| |||||||||||||| |
|
|
| T |
56333962 |
cagccagggcacttgtattgcttga |
56333938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 14 - 107
Target Start/End: Original strand, 56334087 - 56334180
Alignment:
| Q |
14 |
gtgactatgcagacagaatttcaagttttgtgactccattcctactgtctactatttatgggaatttgcgtttttaagtagtcattggcaacaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56334087 |
gtgactatgcagacagaatttcaagttttgtgactccattcctactgtctactatttatgggaatttgcgtttttaagtagtcattggcaacaa |
56334180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University