View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_154 (Length: 247)
Name: NF9533A_low_154
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_154 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 23 - 232
Target Start/End: Original strand, 36970896 - 36971105
Alignment:
| Q |
23 |
acagatatcatccccattaacggtcttgcgattctccttgtgacacttgtcagatgcctcacctgtcacgaaacttatgaactctgtcgcacattcttgc |
122 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36970896 |
acagatatcgtccccattaacggtcttgcgattctccttgtgacacttgtcagatgcttcacctgtcacgaaacttatgaattctgtcgcacattcttgc |
36970995 |
T |
|
| Q |
123 |
atcaactgtttgctttcttttgagatctttgcattgggaggaagattttgcttcattattctacccacattcgctatgggcaacgttttatctccttcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36970996 |
atcaactgtttgctttcttttgagatctttgcattgggaggaagattttgcttcattattctacccacattcgctatgggcaacgttttatctccctcat |
36971095 |
T |
|
| Q |
223 |
cgttcatttc |
232 |
Q |
| |
|
|||||||||| |
|
|
| T |
36971096 |
cgttcatttc |
36971105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 39786325 - 39786381
Alignment:
| Q |
29 |
atcatccccattaacggtcttgcgattctccttgtgacacttgtcagatgcctcacc |
85 |
Q |
| |
|
|||||| ||||| || |||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
39786325 |
atcatcaccattcactgtcttgcgcttctccttgtgacacttgtcagatgcttcacc |
39786381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University