View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_169 (Length: 242)
Name: NF9533A_low_169
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_169 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 6 - 242
Target Start/End: Complemental strand, 10560292 - 10560056
Alignment:
| Q |
6 |
ctgatatgaagggacctttataggtggtgtgaagagtgattttagccctccgcatcaccctttctttagatctcgcggtgtatcaagtaccagtatattt |
105 |
Q |
| |
|
|||| ||| |||||||| |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10560292 |
ctgagatgtagggacctctataggtggtgtgaagagtggttttagccctctgcatcaccctttctttagatctcgcggtgtatcaagcaccagtatattt |
10560193 |
T |
 |
| Q |
106 |
ggattatgtagaaataacacaatcgggacggtcaaatgcttaacaacggtggttgtttacaacacatgttttgcgtgacgattcaaagttgtttgtgttt |
205 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10560192 |
ggattatgtagaaataacacaatcgtgacggtcaaatgcttaacagcggtggttgtttacaacacatgttttgcgtgacgattcaaagttgtttgtgttt |
10560093 |
T |
 |
| Q |
206 |
gtagttcctcttaaaggtggtccaatgctatagaggg |
242 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
10560092 |
gtagttccccttaaaggtgatccaatgctatagaggg |
10560056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University