View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_183 (Length: 238)
Name: NF9533A_low_183
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_183 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 21 - 218
Target Start/End: Original strand, 29690729 - 29690926
Alignment:
| Q |
21 |
gaacgatcttctctgcaaaatatctaacttcccattgaaaaaactcacatcactcaaactccctgtccctaccccctttccagcagatggcttgctcgca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29690729 |
gaacgatcttctctgcaaaatatctaacttcccattgaaaaaactcacatcactcaaactccctgtccctaccccctttccagcagatggcttgctcgca |
29690828 |
T |
|
| Q |
121 |
ttctgccaaaccgttacaacattgacctctctcacttgttcccgtgcttcttttgttcacagccagctcttacccgttgctcattgtttccctttgct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29690829 |
ttctgccaaaccgttacaacattgacctctctcacttgttcccgtgcttcttttgttcacagccagctcttacccgttgctcattgtttccctttgct |
29690926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 21 - 218
Target Start/End: Original strand, 29718241 - 29718438
Alignment:
| Q |
21 |
gaacgatcttctctgcaaaatatctaacttcccattgaaaaaactcacatcactcaaactccctgtccctaccccctttccagcagatggcttgctcgca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29718241 |
gaacgatcttctctgcaaaatatctaacttcccattgaaaaaactcacatcactcaaactccctgtccctaccccctttccagcagatggcttgctcgca |
29718340 |
T |
|
| Q |
121 |
ttctgccaaaccgttacaacattgacctctctcacttgttcccgtgcttcttttgttcacagccagctcttacccgttgctcattgtttccctttgct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29718341 |
ttctgccaaaccgttacaacattgacctctctcacttgttcccgtgcttcttttgttcacagccagctcttacccgttgctcattgtttccctttgct |
29718438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 23 - 84
Target Start/End: Complemental strand, 30827938 - 30827877
Alignment:
| Q |
23 |
acgatcttctctgcaaaatatctaacttcccattgaaaaaactcacatcactcaaactccct |
84 |
Q |
| |
|
|||| |||||| |||||| ||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30827938 |
acgaacttctcatcaaaatctctaatttcccattgaaacaactcacatcactcaaactccct |
30827877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University