View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_188 (Length: 237)
Name: NF9533A_low_188
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_188 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 123 - 233
Target Start/End: Complemental strand, 16552082 - 16551972
Alignment:
| Q |
123 |
ttctccttcctttttaagtctcacggaaattgctccttcctttttacattaaaagtctcactgaaatagaagttgaaatcaatagataaaatctcaaaaa |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16552082 |
ttctccttcctttttaagtctcacagaaattgctccttcctttttacattaaaagtctcactgaaatagaagttgaaatcaatagataaaatctcaaaaa |
16551983 |
T |
 |
| Q |
223 |
agaaagtaaac |
233 |
Q |
| |
|
||||||||||| |
|
|
| T |
16551982 |
agaaagtaaac |
16551972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 150 - 189
Target Start/End: Complemental strand, 16552122 - 16552083
Alignment:
| Q |
150 |
aattgctccttcctttttacattaaaagtctcactgaaat |
189 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16552122 |
aatttctccttcctttttacattaaaagtctcacagaaat |
16552083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University