View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_222 (Length: 228)
Name: NF9533A_low_222
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_222 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 55654467 - 55654648
Alignment:
| Q |
18 |
aatatcaaacacactcttgtatatattgaccaatttgaatccgctataagattaatttttgagttaacgatcgcttatactatatcttccaaatgtgcga |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||| |||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
55654467 |
aatatcaaacacactctcgtatatattgaccaatttaaatccactataagattaatttttaagttaacgatcg-ttagactatatcttccaaatgtgcga |
55654565 |
T |
 |
| Q |
118 |
ctccatgaattgaacctagattgtttttctaagtaaagtgatgttgccaactctaccatcatcatattggtgacgtgatctta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55654566 |
ctccatgaattgaacctagattgtttttctaagtaaagtgatgttgccaactctaccatcatcatattggtgacgtgatctta |
55654648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University