View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_238 (Length: 221)
Name: NF9533A_low_238
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_238 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 5 - 221
Target Start/End: Complemental strand, 36163109 - 36162892
Alignment:
| Q |
5 |
gttataccacagcatagtttaaaatagggcaaaattaacaagcgtgtaaaaatacaaggcacatccaattgtcaagaactcaagacagatagtttagtaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36163109 |
gttataccacagcatagtttaaaatagggcaaaattaacaagcgtgtaaaaatacaaggcacatccaattgtcaagaactcaagtcagatagtttagtaa |
36163010 |
T |
|
| Q |
105 |
aaatacaaggccagtcttaatcaacttaaatgcagtaagacggat-nnnnnnnggacagcaagaggtttcaccttaaggagatacagctgggtcaaattc |
203 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36163009 |
aaatacaaggccagtcttaatcaactttaatgcagtaagacggataaaaaaaaggacagcaagaggcttcaccttaaggagatacagctgggtcaaattc |
36162910 |
T |
|
| Q |
204 |
aagtcgacacatgataga |
221 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
36162909 |
aagttgacacatgataga |
36162892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University