View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9533A_low_246 (Length: 214)
Name: NF9533A_low_246
Description: NF9533A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9533A_low_246 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 30 - 193
Target Start/End: Original strand, 26871947 - 26872110
Alignment:
| Q |
30 |
tgaagaaaagggtgcaggtagcagatattgcatttagagaacttgaagtgatatcatttagaaatataacatggtttgttaagaactactcttggacagt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26871947 |
tgaagaaaagggtgcaggtagcagatattgcatttagacaacttgaagtgatatcatttggaaatataacatggtttgttaagaactactcttggacagt |
26872046 |
T |
|
| Q |
130 |
agtgaatgtaagagactaagaaaagtgaaggagaaacatttttctctttaggctaccacagtaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26872047 |
agtgaatgtaagagactaagaaaagtgaaggagaaacatttttctctttaggctaccacagtaa |
26872110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University